Incidental Mutation 'R3156:Adra2b'
ID263488
Institutional Source Beutler Lab
Gene Symbol Adra2b
Ensembl Gene ENSMUSG00000058620
Gene Nameadrenergic receptor, alpha 2b
Synonymsalpha2B, [a]2B, Adra-2b
MMRRC Submission 040607-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R3156 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location127363208-127367221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127363650 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 29 (L29P)
Ref Sequence ENSEMBL: ENSMUSP00000071798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071902] [ENSMUST00000104934]
Predicted Effect probably damaging
Transcript: ENSMUST00000071902
AA Change: L29P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071798
Gene: ENSMUSG00000058620
AA Change: L29P

DomainStartEndE-ValueType
Pfam:7tm_4 23 168 1.7e-9 PFAM
Pfam:7TM_GPCR_Srx 25 159 9.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 28 218 1.2e-10 PFAM
Pfam:7tm_1 34 429 6.8e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000104934
AA Change: L24P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100539
Gene: ENSMUSG00000058620
AA Change: L24P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 20 154 4e-9 PFAM
Pfam:7TM_GPCR_Srsx 23 213 1.9e-10 PFAM
Pfam:7tm_1 29 424 7e-77 PFAM
Meta Mutation Damage Score 0.4260 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a seven-pass transmembrane protein. This protein is a member of a subfamily of G protein-coupled receptors that regulate neurotransmitter release from sympathetic nerves and from adrenergic neurons in the central nervous system. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice exhibit poor survival and breeding, lack the vasoconstrictor response to alpha2-adrenergic receptor agonists, and display background strain dependent postnatal respiratory failure. Heterozygotes show an attenuated hypertensive response to subtotal nephrectomy and salt loading. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Adra2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03181:Adra2b APN 2 127363983 missense probably benign 0.09
R0081:Adra2b UTSW 2 127364292 missense probably benign
R1964:Adra2b UTSW 2 127363814 missense probably damaging 1.00
R2265:Adra2b UTSW 2 127363871 missense probably damaging 1.00
R3818:Adra2b UTSW 2 127363835 nonsense probably null
R4818:Adra2b UTSW 2 127364092 nonsense probably null
R5893:Adra2b UTSW 2 127364482 missense probably benign 0.01
Z1176:Adra2b UTSW 2 127364038 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATAGATGGTCCTGGGTGTCC -3'
(R):5'- GTACAGAAGAGCACGTCTAGC -3'

Sequencing Primer
(F):5'- AGGCTACGGTGCTCCAGAG -3'
(R):5'- AAGAGCACGTCTAGCGCCAG -3'
Posted On2015-02-05