Incidental Mutation 'R3156:Fut2'
ID 263495
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
MMRRC Submission 040607-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3156 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45648591-45666394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45650667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 227 (L227Q)
Ref Sequence ENSEMBL: ENSMUSP00000063719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: L227Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: L227Q

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210213
Predicted Effect probably benign
Transcript: ENSMUST00000210620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210957
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211324
Meta Mutation Damage Score 0.3712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R0553:Fut2 UTSW 7 45651274 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
R9087:Fut2 UTSW 7 45651069 missense probably damaging 1.00
R9097:Fut2 UTSW 7 45650951 missense probably benign 0.01
R9462:Fut2 UTSW 7 45651068 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTGGCTAGGTAGATGGTATCACC -3'
(R):5'- TGAAGGAGTTCACCCTGCAC -3'

Sequencing Primer
(F):5'- CCCAAAGGTTCCAATGGTCATGATG -3'
(R):5'- ACGACCATGTGCGTGAG -3'
Posted On 2015-02-05