Incidental Mutation 'R3156:Setbp1'
ID263520
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission 040607-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R3156 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78859303 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 383 (V383A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: V383A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: V383A

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161465
AA Change: V383A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: V383A

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7840:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R8147:Setbp1 UTSW 18 78856800 missense probably damaging 1.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGCTGCTCATGGAAATCC -3'
(R):5'- CAGCCATTGGGAGATCAAGATG -3'

Sequencing Primer
(F):5'- GCTGCTCATGGAAATCCCTGAAG -3'
(R):5'- ACTCTCAGTAGCAAGAAGAAGTC -3'
Posted On2015-02-05