Incidental Mutation 'R3156:Hps6'
ID 263522
Institutional Source Beutler Lab
Gene Symbol Hps6
Ensembl Gene ENSMUSG00000074811
Gene Name HPS6, biogenesis of lysosomal organelles complex 2 subunit 3
Synonyms 5330434M19Rik, BLOC-2, ruby eye, ru
MMRRC Submission 040607-MU
Accession Numbers

MGI: 2181763

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3156 (G1)
Quality Score 180
Status Validated
Chromosome 19
Chromosomal Location 46003478-46006173 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 46003741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 39 (D39G)
Ref Sequence ENSEMBL: ENSMUSP00000096991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099393]
AlphaFold Q8BLY7
Predicted Effect probably damaging
Transcript: ENSMUST00000099393
AA Change: D39G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096991
Gene: ENSMUSG00000074811
AA Change: D39G

DomainStartEndE-ValueType
Pfam:HPS6 1 772 1e-281 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181820
Meta Mutation Damage Score 0.1351 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. This protein interacts with Hermansky-Pudlak syndrome 5 protein. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 6. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in hypopigmented hair and eyes, and increased clotting time due to a platelet dense granule defect. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Spontaneous(8) Chemically induced(1)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Col4a2 T A 8: 11,313,414 probably benign Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Hps6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Hps6 APN 19 46003660 missense probably damaging 1.00
IGL02826:Hps6 APN 19 46006041 makesense probably null
stamper-coat UTSW 19 46003836 missense probably damaging 1.00
R0299:Hps6 UTSW 19 46004232 missense probably damaging 0.98
R0613:Hps6 UTSW 19 46003821 missense probably benign
R1036:Hps6 UTSW 19 46004241 missense probably benign 0.00
R1845:Hps6 UTSW 19 46004970 missense probably benign 0.30
R1959:Hps6 UTSW 19 46004335 missense probably benign 0.33
R2271:Hps6 UTSW 19 46005682 missense possibly damaging 0.86
R2332:Hps6 UTSW 19 46004491 missense possibly damaging 0.82
R3937:Hps6 UTSW 19 46004053 missense probably damaging 0.97
R7108:Hps6 UTSW 19 46005490 missense probably damaging 1.00
R7384:Hps6 UTSW 19 46004017 missense possibly damaging 0.96
R7710:Hps6 UTSW 19 46004568 missense probably benign 0.03
R8444:Hps6 UTSW 19 46005428 missense possibly damaging 0.72
R8530:Hps6 UTSW 19 46003520 start gained probably benign
R8773:Hps6 UTSW 19 46005702 missense possibly damaging 0.92
R8868:Hps6 UTSW 19 46004007 missense possibly damaging 0.89
R9329:Hps6 UTSW 19 46004103 missense probably benign 0.00
R9385:Hps6 UTSW 19 46005910 missense probably damaging 0.97
R9803:Hps6 UTSW 19 46005508 nonsense probably null
X0065:Hps6 UTSW 19 46004166 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCACCTCATTCACCAGGGAC -3'
(R):5'- AGTAGCTTCCATCCAGGCTC -3'

Sequencing Primer
(F):5'- CTCATTCACCAGGGACGGAAG -3'
(R):5'- GCTAGGCCACTCTCCCATAC -3'
Posted On 2015-02-05