Incidental Mutation 'R3157:Npas2'
Institutional Source Beutler Lab
Gene Symbol Npas2
Ensembl Gene ENSMUSG00000026077
Gene Nameneuronal PAS domain protein 2
SynonymsbHLHe9, MOP4
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3157 (G1)
Quality Score225
Status Validated
Chromosomal Location39193731-39363236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39347609 bp
Amino Acid Change Threonine to Methionine at position 653 (T653M)
Ref Sequence ENSEMBL: ENSMUSP00000054719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056815
AA Change: T653M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000054719
Gene: ENSMUSG00000026077
AA Change: T653M

HLH 15 65 6.56e-10 SMART
PAS 84 150 4.28e-10 SMART
PAS 239 305 4.03e-6 SMART
PAC 311 354 6.2e-7 SMART
low complexity region 400 419 N/A INTRINSIC
coiled coil region 510 538 N/A INTRINSIC
low complexity region 563 583 N/A INTRINSIC
low complexity region 623 643 N/A INTRINSIC
low complexity region 745 768 N/A INTRINSIC
low complexity region 798 816 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172825
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. The encoded protein may play a regulatory role in the acquisition of specific types of memory. It also may function as a part of a molecular clock operative in the mammalian forebrain. [provided by RefSeq, Dec 2014]
PHENOTYPE: Targeted mutation of this gene results in deficits in complex emotional long-term memory tasks [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Npas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Npas2 APN 1 39333961 splice site probably benign
IGL02608:Npas2 APN 1 39345446 missense probably benign 0.06
IGL02882:Npas2 APN 1 39312996 missense probably benign 0.08
IGL02976:Npas2 APN 1 39287484 missense probably damaging 1.00
IGL03130:Npas2 APN 1 39313028 missense probably damaging 1.00
IGL03297:Npas2 APN 1 39292690 missense possibly damaging 0.71
R1263:Npas2 UTSW 1 39334768 missense possibly damaging 0.51
R1514:Npas2 UTSW 1 39311854 missense possibly damaging 0.82
R1618:Npas2 UTSW 1 39300727 missense probably damaging 1.00
R1620:Npas2 UTSW 1 39333912 missense possibly damaging 0.68
R1844:Npas2 UTSW 1 39325375 missense probably damaging 1.00
R1868:Npas2 UTSW 1 39300678 missense probably benign 0.03
R1892:Npas2 UTSW 1 39345422 missense probably benign 0.00
R2002:Npas2 UTSW 1 39338195 missense probably benign 0.10
R3551:Npas2 UTSW 1 39287562 missense probably benign 0.05
R4564:Npas2 UTSW 1 39287566 missense probably damaging 1.00
R4907:Npas2 UTSW 1 39361985 missense unknown
R5044:Npas2 UTSW 1 39347506 nonsense probably null
R5621:Npas2 UTSW 1 39359713 missense probably benign
R5779:Npas2 UTSW 1 39287571 missense possibly damaging 0.48
R5822:Npas2 UTSW 1 39347566 missense probably benign 0.00
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6033:Npas2 UTSW 1 39338180 missense probably damaging 0.99
R6155:Npas2 UTSW 1 39287476 missense probably damaging 1.00
R6193:Npas2 UTSW 1 39292762 missense probably damaging 1.00
R6220:Npas2 UTSW 1 39336061 missense probably benign 0.00
R6341:Npas2 UTSW 1 39300687 missense probably damaging 0.98
R6656:Npas2 UTSW 1 39361948 missense unknown
R6778:Npas2 UTSW 1 39325300 missense possibly damaging 0.92
R6803:Npas2 UTSW 1 39336049 missense probably benign 0.35
R7165:Npas2 UTSW 1 39292717 missense possibly damaging 0.79
R7250:Npas2 UTSW 1 39338107 missense probably damaging 1.00
R7268:Npas2 UTSW 1 39287577 missense probably damaging 0.98
R7284:Npas2 UTSW 1 39324467 missense probably benign 0.36
R7833:Npas2 UTSW 1 39326147 missense probably damaging 1.00
R7994:Npas2 UTSW 1 39328337 missense possibly damaging 0.86
R8013:Npas2 UTSW 1 39338065 missense probably benign
R8054:Npas2 UTSW 1 39287571 missense possibly damaging 0.69
R8510:Npas2 UTSW 1 39287472 missense probably damaging 1.00
R8683:Npas2 UTSW 1 39347627 missense probably benign 0.00
R8738:Npas2 UTSW 1 39292716 missense possibly damaging 0.65
R8779:Npas2 UTSW 1 39338186 missense probably damaging 0.99
Z1176:Npas2 UTSW 1 39336010 missense probably benign 0.03
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-02-05