Mutagenetix > Incidental Mutation

Incidental Mutation 'R0324:Scnn1g'

26353

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

038534-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.536) question?

Stock #

R0324 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121740555 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 192 (I192M)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

possibly damaging
Transcript: ENSMUST00000000221
AA Change: I192M

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: I192M

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 96.1%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	T	C	17: 9,001,157	L357S	probably benign	Het
1700129C05Rik	C	T	14: 59,142,807	R14H	probably damaging	Het
4933417A18Rik	A	G	13: 34,924,613	N26S	probably benign	Het
Aatf	A	G	11: 84,512,139		probably null	Het
Abca13	T	A	11: 9,297,669	M2472K	possibly damaging	Het
Abcd3	C	A	3: 121,769,167	Q540H	probably null	Het
Adam17	C	T	12: 21,349,938	V156I	probably benign	Het
Adam26a	A	G	8: 43,568,453	S667P	probably benign	Het
Adcy10	A	G	1: 165,564,249	K1333E	probably benign	Het
Apob	G	A	12: 8,010,521	R2968Q	probably benign	Het
Arap3	G	A	18: 37,973,225	P1522S	possibly damaging	Het
Catsper1	A	T	19: 5,336,545	S269C	probably damaging	Het
Cd209d	A	T	8: 3,878,258	S42R	probably benign	Het
Cntln	T	A	4: 85,092,695	V1049E	probably damaging	Het
Cracr2b	T	C	7: 141,463,746	F87L	probably damaging	Het
Crb3	T	C	17: 57,065,133	L60P	probably damaging	Het
Crispld1	T	C	1: 17,749,591	V271A	probably benign	Het
Cyp2c66	G	T	19: 39,176,691	R372L	probably benign	Het
Ddx58	T	C	4: 40,213,766	T586A	probably benign	Het
Deup1	G	A	9: 15,582,533	R438W	probably benign	Het
Dnah6	C	T	6: 73,173,558	E741K	possibly damaging	Het
Epha4	T	C	1: 77,383,551	E703G	probably damaging	Het
Evc2	G	A	5: 37,393,099	R819H	probably damaging	Het
Fam217a	A	C	13: 34,910,961	C272G	possibly damaging	Het
Fndc7	T	C	3: 108,876,699		probably null	Het
Foxs1	C	T	2: 152,932,687	G149S	probably benign	Het
Galnt13	T	C	2: 54,854,616	V109A	probably benign	Het
Hmgxb4	G	A	8: 74,998,928	M7I	probably benign	Het
Klk1b1	T	A	7: 43,970,741	C209*	probably null	Het
Klra10	A	G	6: 130,272,650		probably null	Het
Kntc1	A	T	5: 123,778,112	K701N	probably damaging	Het
Lpgat1	T	A	1: 191,749,642	L114Q	probably damaging	Het
Mecom	T	A	3: 29,963,112	Q468L	probably damaging	Het
Med15	T	C	16: 17,697,612	T70A	probably damaging	Het
Msh6	T	A	17: 87,986,620	Y934*	probably null	Het
Mtus1	T	C	8: 41,084,395	T95A	probably benign	Het
Mylk3	C	A	8: 85,352,906	R444S	probably damaging	Het
Nbea	A	G	3: 56,057,948		probably null	Het
Nbeal1	T	C	1: 60,292,873	V2242A	probably damaging	Het
Nhp2	A	G	11: 51,622,507	T85A	possibly damaging	Het
Nlk	A	G	11: 78,572,431	S413P	possibly damaging	Het
Nmbr	A	G	10: 14,760,448	I54V	possibly damaging	Het
Nmur2	A	T	11: 56,040,520	C122S	probably damaging	Het
Nudt13	G	T	14: 20,311,515	V220L	probably damaging	Het
Olfr1025-ps1	G	A	2: 85,917,951	V9M	probably benign	Het
Pclo	G	A	5: 14,669,433	G1195R	unknown	Het
Pcsk7	A	G	9: 45,913,011	H276R	possibly damaging	Het
Pdss2	T	C	10: 43,393,928	S256P	probably damaging	Het
Pgf	G	T	12: 85,171,424	H116N	probably benign	Het
Pglyrp2	T	C	17: 32,418,328	D242G	probably benign	Het
Plk2	G	A	13: 110,397,708	R274K	probably benign	Het
Ppp6r3	G	T	19: 3,464,693	P141T	probably benign	Het
Prss54	T	C	8: 95,565,667	T95A	probably benign	Het
Rab3il1	A	G	19: 10,028,289	D149G	probably damaging	Het
Rasgef1c	T	C	11: 49,961,230		probably null	Het
Rhpn1	T	C	15: 75,711,588	M334T	probably damaging	Het
Robo2	C	T	16: 73,967,851	V630M	probably damaging	Het
Rptor	C	T	11: 119,892,641	R1154W	probably damaging	Het
Sit1	G	A	4: 43,482,815	Q115*	probably null	Het
Slc13a2	T	C	11: 78,404,524	N141S	probably damaging	Het
Slc19a2	C	A	1: 164,256,775	T78K	probably damaging	Het
Snx14	A	G	9: 88,405,238		probably null	Het
Stil	T	A	4: 115,039,149	C944S	probably benign	Het
Tnfaip2	A	G	12: 111,453,459	N675S	probably damaging	Het
Trim30c	A	G	7: 104,383,309	I270T	possibly damaging	Het
Ugt2a3	C	T	5: 87,327,073		probably null	Het
Vmn1r213	A	T	13: 23,011,418		probably benign	Het
Vmn2r8	A	C	5: 108,797,941		probably null	Het
Vps13c	T	C	9: 67,964,309	F3253L	possibly damaging	Het
Zbtb16	G	T	9: 48,665,275	Q502K	possibly damaging	Het
Zfp143	A	G	7: 110,077,147	K218E	possibly damaging	Het
Zfp946	A	G	17: 22,454,436	N57S	probably benign	Het
Zfp985	T	C	4: 147,582,857	Y61H	probably benign	Het
Zkscan1	G	A	5: 138,097,523	R246Q	probably damaging	Het
Zpld1	A	G	16: 55,251,615	F94L	probably damaging	Het
Zswim5	G	T	4: 116,986,906	W1047L	probably damaging	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R5910:Scnn1g	UTSW	7	121738095	missense	probably damaging	0.99
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTGACCTCCTGACTGACTTGGAC -3'
(R):5'- TCCACATGCTGAAGCCAGCTTG -3'

Sequencing Primer
(F):5'- CCTGACTGACTTGGACAGTGAG -3'
(R):5'- GTGCTTGCCACCAACTCAG -3'

Posted On

2013-04-16