Incidental Mutation 'R3157:Galnt12'
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3157 (G1)
Quality Score217
Status Validated
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47104264 bp
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000045721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably damaging
Transcript: ENSMUST00000045041
AA Change: D174G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: D174G

transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107744
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774

Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179673
Meta Mutation Damage Score 0.2392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3158:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
R7810:Galnt12 UTSW 4 47113786 missense probably damaging 1.00
R8823:Galnt12 UTSW 4 47091928 start gained probably benign
R8871:Galnt12 UTSW 4 47108582 critical splice donor site probably null
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-02-05