Incidental Mutation 'R3157:Adarb2'
ID263557
Institutional Source Beutler Lab
Gene Symbol Adarb2
Ensembl Gene ENSMUSG00000052551
Gene Nameadenosine deaminase, RNA-specific, B2
SynonymsAdar3, RED2
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3157 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location8202866-8768747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8697633 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 408 (K408N)
Ref Sequence ENSEMBL: ENSMUSP00000115148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064473] [ENSMUST00000123187] [ENSMUST00000135574]
Predicted Effect probably benign
Transcript: ENSMUST00000064473
AA Change: K408N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000064775
Gene: ENSMUSG00000052551
AA Change: K408N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123187
AA Change: K408N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120757
Gene: ENSMUSG00000052551
AA Change: K408N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 6.1e-19 SMART
DSRM 284 346 7.3e-18 SMART
ADEAMc 366 698 2e-164 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135574
AA Change: K408N

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115148
Gene: ENSMUSG00000052551
AA Change: K408N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
DSRM 126 190 1.03e-16 SMART
DSRM 284 346 1.24e-15 SMART
ADEAMc 366 742 5.41e-211 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the double-stranded RNA adenosine deaminase family of RNA-editing enzymes and may play a regulatory role in RNA editing. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Adarb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Adarb2 APN 13 8701725 missense probably benign 0.00
IGL00910:Adarb2 APN 13 8672433 missense probably damaging 1.00
IGL01308:Adarb2 APN 13 8203293 missense possibly damaging 0.93
IGL01337:Adarb2 APN 13 8570246 missense probably benign 0.03
IGL01508:Adarb2 APN 13 8752570 splice site probably null
IGL01792:Adarb2 APN 13 8570149 missense probably damaging 1.00
IGL02387:Adarb2 APN 13 8569958 missense probably damaging 1.00
IGL02423:Adarb2 APN 13 8569720 missense probably damaging 0.99
R0304:Adarb2 UTSW 13 8752570 splice site probably benign
R0463:Adarb2 UTSW 13 8203188 start gained probably benign
R0646:Adarb2 UTSW 13 8731819 missense probably damaging 1.00
R0963:Adarb2 UTSW 13 8672415 missense probably damaging 1.00
R1066:Adarb2 UTSW 13 8757323 missense probably benign 0.14
R1451:Adarb2 UTSW 13 8339621 intron probably benign
R1656:Adarb2 UTSW 13 8203251 missense unknown
R1939:Adarb2 UTSW 13 8203322 critical splice donor site probably null
R2212:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R2484:Adarb2 UTSW 13 8569774 nonsense probably null
R2993:Adarb2 UTSW 13 8713716 missense probably benign 0.02
R3177:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3277:Adarb2 UTSW 13 8752627 missense probably damaging 1.00
R3412:Adarb2 UTSW 13 8752618 missense probably damaging 1.00
R3949:Adarb2 UTSW 13 8570419 missense probably damaging 0.97
R4505:Adarb2 UTSW 13 8697691 missense probably damaging 1.00
R5232:Adarb2 UTSW 13 8713640 missense possibly damaging 0.80
R5831:Adarb2 UTSW 13 8559133 missense probably benign 0.45
R7113:Adarb2 UTSW 13 8731845 missense probably damaging 0.99
R7252:Adarb2 UTSW 13 8570180 missense probably benign 0.00
R7259:Adarb2 UTSW 13 8570252 missense probably benign
R7346:Adarb2 UTSW 13 8570384 missense probably damaging 1.00
R7422:Adarb2 UTSW 13 8757277 missense possibly damaging 0.83
R7724:Adarb2 UTSW 13 8570256 missense probably benign 0.34
R7733:Adarb2 UTSW 13 8752608 missense possibly damaging 0.82
R7749:Adarb2 UTSW 13 8569739 missense possibly damaging 0.96
Z1177:Adarb2 UTSW 13 8570200 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGATGTCTATCAAAACAGAACCTGA -3'
(R):5'- AGGGGCCCCTTTACCTCAAG -3'

Sequencing Primer
(F):5'- TGAGGCATGTCTAACAAGTCTCC -3'
(R):5'- TTACCTCAAGTGCAGCTCCAG -3'
Posted On2015-02-05