Incidental Mutation 'R3157:Kcnh8'
ID263568
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission 040608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3157 (G1)
Quality Score165
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationsmall deletion (8 aa in frame mutation)
DNA Base Change (assembly) GAGACCAACGAGCAGCTGATGCTTCAGA to GAGA at 52725906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably benign
Transcript: ENSMUST00000039366
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb2 A T 13: 8,697,633 K408N probably benign Het
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ap1g2 A T 14: 55,099,274 I747N probably damaging Het
Arhgap27 T A 11: 103,333,837 probably null Het
Bmp1 G T 14: 70,492,107 N541K possibly damaging Het
Cacna1c T A 6: 118,751,524 T320S probably benign Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
D630003M21Rik A C 2: 158,195,472 probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dock8 T C 19: 25,149,831 Y1058H probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Fnip2 T C 3: 79,567,594 T4A probably damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmcn2 A G 2: 31,400,255 N2367D probably damaging Het
Hydin A G 8: 110,267,373 K13R unknown Het
Kcns1 G A 2: 164,164,945 A366V probably damaging Het
Kif5a A T 10: 127,245,441 I208N probably damaging Het
Klrb1c G T 6: 128,784,739 T134K possibly damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mgat4d T C 8: 83,354,821 Y68H probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Ncapg T A 5: 45,676,058 D295E probably benign Het
Npas2 C T 1: 39,347,609 T653M possibly damaging Het
Nps A G 7: 135,272,260 D53G probably benign Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Pcdha2 A G 18: 36,940,092 T259A probably damaging Het
Pced1a A G 2: 130,419,767 M322T probably benign Het
Pcgf6 T C 19: 47,040,036 probably benign Het
Pigg C T 5: 108,314,148 T115I probably damaging Het
Plcd4 G A 1: 74,551,154 probably null Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Rasal2 A G 1: 157,158,655 probably benign Het
Rec8 A G 14: 55,625,306 E574G probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Slc16a8 T C 15: 79,252,175 I276V probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Synpr C T 14: 13,493,614 A64V possibly damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tpt1 G A 14: 75,846,400 probably benign Het
Trav18 A G 14: 53,831,695 T65A probably benign Het
Ttll4 T C 1: 74,697,611 L1165P possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7372:Kcnh8 UTSW 17 52894101 missense probably damaging 1.00
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTGACTGAAGTTGTGTCTTAAAC -3'
(R):5'- CCATGTTCCCTGGAGAACTTC -3'

Sequencing Primer
(F):5'- GACTGAAGTTGTGTCTTAAACAAAAG -3'
(R):5'- CTTCTCCCAAACACTATAATTGAGTG -3'
Posted On2015-02-05