Incidental Mutation 'R0324:Adam26a'
ID26357
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43568453 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 667 (S667P)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect probably benign
Transcript: ENSMUST00000049577
AA Change: S667P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: S667P

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0830:Adam26a UTSW 8 43568402 missense probably benign 0.23
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1259:Adam26a UTSW 8 43568713 missense possibly damaging 0.95
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5406:Adam26a UTSW 8 43569104 missense probably damaging 1.00
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
R7053:Adam26a UTSW 8 43568799 nonsense probably null
R7287:Adam26a UTSW 8 43570343 missense possibly damaging 0.95
R7393:Adam26a UTSW 8 43569688 missense probably benign 0.01
R7477:Adam26a UTSW 8 43569070 missense probably damaging 1.00
R7552:Adam26a UTSW 8 43569970 missense possibly damaging 0.77
R7670:Adam26a UTSW 8 43570153 missense probably benign 0.13
R7918:Adam26a UTSW 8 43569529 missense probably damaging 0.98
R8193:Adam26a UTSW 8 43569236 missense probably damaging 1.00
R8262:Adam26a UTSW 8 43569141 nonsense probably null
R8987:Adam26a UTSW 8 43569321 missense probably benign 0.02
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAACATCCGACCTGGGATTT -3'
(R):5'- GCACAGCTTATGCTCCAGACCAT -3'

Sequencing Primer
(F):5'- aacatacatacacacacacacac -3'
(R):5'- TTGACAGAAAGTGTGTCAGCAAG -3'
Posted On2013-04-16