Incidental Mutation 'R3158:Hsd3b5'
ID263576
Institutional Source Beutler Lab
Gene Symbol Hsd3b5
Ensembl Gene ENSMUSG00000038092
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms3(beta)HSDV
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location98618634-98630252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 98622059 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 85 (A85V)
Ref Sequence ENSEMBL: ENSMUSP00000041442 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044094]
Predicted Effect probably benign
Transcript: ENSMUST00000044094
AA Change: A85V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041442
Gene: ENSMUSG00000038092
AA Change: A85V

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 261 1.8e-8 PFAM
Pfam:KR 5 133 3.2e-8 PFAM
Pfam:Polysacc_synt_2 6 134 5.9e-12 PFAM
Pfam:NmrA 6 147 2.7e-12 PFAM
Pfam:Epimerase 6 249 1.2e-23 PFAM
Pfam:GDP_Man_Dehyd 7 187 5.6e-12 PFAM
Pfam:3Beta_HSD 7 288 2e-105 PFAM
Pfam:NAD_binding_4 8 220 3.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196741
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Hsd3b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Hsd3b5 APN 3 98630057 missense probably benign 0.05
IGL00827:Hsd3b5 APN 3 98630098 missense probably benign 0.00
IGL01530:Hsd3b5 APN 3 98619123 missense probably damaging 1.00
IGL01930:Hsd3b5 APN 3 98622159 missense probably benign 0.01
IGL02363:Hsd3b5 APN 3 98630105 missense probably benign 0.08
IGL02396:Hsd3b5 APN 3 98622027 missense probably benign 0.05
IGL02448:Hsd3b5 APN 3 98622131 missense probably damaging 1.00
R0045:Hsd3b5 UTSW 3 98619144 missense probably benign
R0624:Hsd3b5 UTSW 3 98619404 missense probably damaging 0.98
R0745:Hsd3b5 UTSW 3 98619539 missense probably benign 0.12
R0848:Hsd3b5 UTSW 3 98619355 missense probably damaging 1.00
R1112:Hsd3b5 UTSW 3 98630077 missense probably benign 0.00
R1454:Hsd3b5 UTSW 3 98619530 missense probably benign 0.01
R1631:Hsd3b5 UTSW 3 98622077 missense probably damaging 1.00
R1657:Hsd3b5 UTSW 3 98619720 missense possibly damaging 0.89
R1839:Hsd3b5 UTSW 3 98619728 missense probably benign 0.30
R2930:Hsd3b5 UTSW 3 98619212 missense probably benign 0.03
R2982:Hsd3b5 UTSW 3 98619800 missense possibly damaging 0.88
R4573:Hsd3b5 UTSW 3 98619648 missense probably benign 0.04
R4941:Hsd3b5 UTSW 3 98619063 missense probably damaging 1.00
R5104:Hsd3b5 UTSW 3 98619276 missense probably damaging 1.00
R5416:Hsd3b5 UTSW 3 98619150 missense probably damaging 1.00
R6311:Hsd3b5 UTSW 3 98630090 missense possibly damaging 0.79
R6861:Hsd3b5 UTSW 3 98622012 missense probably damaging 1.00
R7307:Hsd3b5 UTSW 3 98619769 missense probably damaging 0.97
R7339:Hsd3b5 UTSW 3 98622074 missense probably damaging 1.00
R7615:Hsd3b5 UTSW 3 98630104 missense probably damaging 0.99
R7673:Hsd3b5 UTSW 3 98619441 missense probably damaging 1.00
R7883:Hsd3b5 UTSW 3 98622140 missense probably benign 0.00
R8398:Hsd3b5 UTSW 3 98619404 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGCAGGTATCCCATGGTTGG -3'
(R):5'- TGACTGCCCTTGAAGACCTAC -3'

Sequencing Primer
(F):5'- GGGACATCCTCATTTACCCAC -3'
(R):5'- TGCCCTTGAAGACCTACATAAATG -3'
Posted On2015-02-05