Incidental Mutation 'R3158:Clca4b'
Institutional Source Beutler Lab
Gene Symbol Clca4b
Ensembl Gene ENSMUSG00000074195
Gene Namechloride channel accessory 4B
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosomal Location144910921-144932529 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 144912117 bp
Amino Acid Change Valine to Leucine at position 742 (V742L)
Ref Sequence ENSEMBL: ENSMUSP00000096149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098549]
Predicted Effect probably benign
Transcript: ENSMUST00000098549
AA Change: V742L

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096149
Gene: ENSMUSG00000074195
AA Change: V742L

signal peptide 1 23 N/A INTRINSIC
VWA 306 480 1.03e-15 SMART
Blast:VWA 513 552 6e-16 BLAST
Blast:FN3 757 838 5e-35 BLAST
low complexity region 882 906 N/A INTRINSIC
Meta Mutation Damage Score 0.1240 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: No notable phenotype was detected in a high throughput screen of homozyogus mutant null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Clca4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Clca4b APN 3 144932391 missense probably benign 0.00
IGL00391:Clca4b APN 3 144915561 missense possibly damaging 0.81
IGL00576:Clca4b APN 3 144925347 missense probably damaging 1.00
IGL01484:Clca4b APN 3 144928235 missense probably benign 0.02
IGL01539:Clca4b APN 3 144926157 missense probably benign
IGL01726:Clca4b APN 3 144928342 missense probably damaging 1.00
IGL01903:Clca4b APN 3 144928259 missense probably damaging 0.98
IGL01967:Clca4b APN 3 144928190 splice site probably benign
IGL02002:Clca4b APN 3 144932433 missense probably benign 0.00
IGL02323:Clca4b APN 3 144913321 missense probably benign
IGL02379:Clca4b APN 3 144921858 missense probably benign 0.00
IGL02638:Clca4b APN 3 144926178 missense probably damaging 1.00
IGL02859:Clca4b APN 3 144912039 missense probably benign
R0110:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0266:Clca4b UTSW 3 144922786 missense probably damaging 1.00
R0311:Clca4b UTSW 3 144932496 missense probably benign 0.04
R0348:Clca4b UTSW 3 144921980 missense probably damaging 0.96
R0450:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0510:Clca4b UTSW 3 144913351 missense probably damaging 1.00
R0538:Clca4b UTSW 3 144921956 missense probably benign 0.15
R0551:Clca4b UTSW 3 144928626 missense probably damaging 1.00
R0552:Clca4b UTSW 3 144916775 missense probably benign
R0570:Clca4b UTSW 3 144925349 missense probably benign 0.01
R0591:Clca4b UTSW 3 144915592 nonsense probably null
R0627:Clca4b UTSW 3 144928259 missense probably benign 0.20
R0729:Clca4b UTSW 3 144928350 splice site probably benign
R0844:Clca4b UTSW 3 144916771 missense probably damaging 0.96
R0964:Clca4b UTSW 3 144915576 missense probably benign
R1388:Clca4b UTSW 3 144916654 missense probably benign
R1479:Clca4b UTSW 3 144915468 missense probably damaging 0.99
R1603:Clca4b UTSW 3 144922019 missense probably benign 0.20
R2045:Clca4b UTSW 3 144925163 missense probably damaging 1.00
R2162:Clca4b UTSW 3 144928587 missense probably benign 0.19
R2185:Clca4b UTSW 3 144928556 missense probably damaging 1.00
R2241:Clca4b UTSW 3 144911226 missense probably benign 0.00
R2300:Clca4b UTSW 3 144916671 missense probably benign 0.02
R2321:Clca4b UTSW 3 144932373 missense probably benign 0.00
R2359:Clca4b UTSW 3 144925242 missense probably damaging 0.96
R3105:Clca4b UTSW 3 144916671 missense probably benign 0.02
R3151:Clca4b UTSW 3 144915511 missense probably benign 0.05
R3177:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3277:Clca4b UTSW 3 144911359 missense probably benign 0.15
R3981:Clca4b UTSW 3 144926036 missense probably benign 0.27
R4601:Clca4b UTSW 3 144927184 missense possibly damaging 0.81
R4646:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4647:Clca4b UTSW 3 144928525 missense probably benign 0.00
R4696:Clca4b UTSW 3 144911385 missense probably benign 0.00
R4893:Clca4b UTSW 3 144925173 missense possibly damaging 0.67
R4998:Clca4b UTSW 3 144915508 missense probably benign 0.00
R5053:Clca4b UTSW 3 144911121 missense probably benign 0.01
R5060:Clca4b UTSW 3 144911506 missense probably damaging 1.00
R5319:Clca4b UTSW 3 144925179 missense possibly damaging 0.85
R5409:Clca4b UTSW 3 144916691 nonsense probably null
R5534:Clca4b UTSW 3 144915466 missense probably damaging 1.00
R5578:Clca4b UTSW 3 144932435 missense probably benign 0.04
R5667:Clca4b UTSW 3 144921863 missense probably benign
R5671:Clca4b UTSW 3 144921863 missense probably benign
R5715:Clca4b UTSW 3 144913257 missense probably benign 0.01
R5875:Clca4b UTSW 3 144922889 missense probably benign 0.38
R5876:Clca4b UTSW 3 144912060 missense possibly damaging 0.91
R6122:Clca4b UTSW 3 144926166 missense possibly damaging 0.67
R6294:Clca4b UTSW 3 144925185 missense probably null
R6408:Clca4b UTSW 3 144919275 missense probably benign 0.00
R6418:Clca4b UTSW 3 144928235 missense probably benign 0.02
R6458:Clca4b UTSW 3 144911327 missense possibly damaging 0.77
R6536:Clca4b UTSW 3 144916729 missense possibly damaging 0.66
R6567:Clca4b UTSW 3 144932339 missense possibly damaging 0.96
R6781:Clca4b UTSW 3 144922801 missense probably benign
R6799:Clca4b UTSW 3 144915627 splice site probably null
R7046:Clca4b UTSW 3 144915606 missense probably damaging 1.00
R7365:Clca4b UTSW 3 144922768 missense not run
R7431:Clca4b UTSW 3 144911133 missense probably benign 0.28
R7462:Clca4b UTSW 3 144922860 missense probably benign 0.00
R7611:Clca4b UTSW 3 144921996 missense probably benign 0.03
R7806:Clca4b UTSW 3 144932396 missense probably benign 0.01
R7918:Clca4b UTSW 3 144913272 missense probably damaging 0.99
R7962:Clca4b UTSW 3 144916660 missense possibly damaging 0.63
R7990:Clca4b UTSW 3 144928342 missense probably damaging 1.00
R8198:Clca4b UTSW 3 144932406 missense probably damaging 1.00
R8327:Clca4b UTSW 3 144922001 missense possibly damaging 0.75
R8370:Clca4b UTSW 3 144926063 missense probably damaging 1.00
R8434:Clca4b UTSW 3 144926156 missense probably benign 0.00
R8493:Clca4b UTSW 3 144912150 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-02-05