Incidental Mutation 'R3158:Smu1'
ID263578
Institutional Source Beutler Lab
Gene Symbol Smu1
Ensembl Gene ENSMUSG00000028409
Gene Namesmu-1 suppressor of mec-8 and unc-52 homolog (C. elegans)
Synonyms2610203K23Rik, 2600001O03Rik, SMU-1
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40736542-40757923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40754529 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 123 (R123S)
Ref Sequence ENSEMBL: ENSMUSP00000030117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030117]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030117
AA Change: R123S

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030117
Gene: ENSMUSG00000028409
AA Change: R123S

DomainStartEndE-ValueType
LisH 6 38 9.95e-7 SMART
CTLH 40 92 2.32e-7 SMART
WD40 202 242 9.02e-7 SMART
WD40 253 292 3.81e-5 SMART
WD40 295 335 5.26e-8 SMART
WD40 338 377 4.4e-10 SMART
WD40 380 426 1.03e1 SMART
WD40 428 470 2.97e0 SMART
WD40 473 512 9.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150574
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Smu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02992:Smu1 APN 4 40739550 missense probably damaging 0.97
IGL03271:Smu1 APN 4 40738408 missense probably benign 0.11
IGL03329:Smu1 APN 4 40739568 missense possibly damaging 0.81
PIT4585001:Smu1 UTSW 4 40739623 missense probably benign
R0172:Smu1 UTSW 4 40738439 missense probably benign 0.00
R1109:Smu1 UTSW 4 40755722 missense probably benign 0.12
R1552:Smu1 UTSW 4 40748570 missense probably damaging 1.00
R1799:Smu1 UTSW 4 40745537 missense probably damaging 1.00
R2093:Smu1 UTSW 4 40738438 missense probably benign 0.12
R2143:Smu1 UTSW 4 40744073 missense probably damaging 0.99
R3082:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3083:Smu1 UTSW 4 40745567 missense probably damaging 1.00
R3113:Smu1 UTSW 4 40748658 missense probably benign 0.03
R3157:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3159:Smu1 UTSW 4 40754529 missense possibly damaging 0.82
R3409:Smu1 UTSW 4 40752008 missense probably benign
R3411:Smu1 UTSW 4 40752008 missense probably benign
R4581:Smu1 UTSW 4 40737401 splice site probably null
R5106:Smu1 UTSW 4 40743104 missense possibly damaging 0.82
R7747:Smu1 UTSW 4 40748600 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CTCCACACATGAATGCCTGC -3'
(R):5'- TGACCCTAGCACAGACATCG -3'

Sequencing Primer
(F):5'- TGAATGCCTGCCCAAACAC -3'
(R):5'- GCGGCCTAGTCTACATAGTAAGTTC -3'
Posted On2015-02-05