Incidental Mutation 'R3158:Galnt12'
ID263579
Institutional Source Beutler Lab
Gene Symbol Galnt12
Ensembl Gene ENSMUSG00000039774
Gene Namepolypeptide N-acetylgalactosaminyltransferase 12
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location47091909-47123070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47104264 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 174 (D174G)
Ref Sequence ENSEMBL: ENSMUSP00000045721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045041] [ENSMUST00000107744]
Predicted Effect probably damaging
Transcript: ENSMUST00000045041
AA Change: D174G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045721
Gene: ENSMUSG00000039774
AA Change: D174G

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
low complexity region 78 91 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 131 375 3.4e-10 PFAM
Pfam:Glycos_transf_2 134 317 1.4e-35 PFAM
Pfam:Glyco_tranf_2_2 134 360 6.6e-8 PFAM
Pfam:Glyco_transf_7C 290 363 3e-9 PFAM
RICIN 440 572 8.09e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107744
SMART Domains Protein: ENSMUSP00000103373
Gene: ENSMUSG00000039774

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 5 71 7.5e-9 PFAM
RICIN 148 280 8.09e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179673
Meta Mutation Damage Score 0.242 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases, which catalyze the transfer of N-acetylgalactosamine (GalNAc) from UDP-GalNAc to a serine or threonine residue on a polypeptide acceptor in the initial step of O-linked protein glycosylation. Mutations in this gene are associated with an increased susceptibility to colorectal cancer.[provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Galnt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Galnt12 APN 4 47112315 splice site probably benign
IGL02188:Galnt12 APN 4 47122521 missense probably damaging 1.00
IGL02217:Galnt12 APN 4 47113832 missense probably damaging 1.00
IGL02388:Galnt12 APN 4 47117941 missense probably damaging 1.00
IGL02550:Galnt12 APN 4 47104126 missense possibly damaging 0.47
IGL03062:Galnt12 APN 4 47122566 missense possibly damaging 0.80
R0508:Galnt12 UTSW 4 47104255 missense probably damaging 1.00
R1513:Galnt12 UTSW 4 47117956 missense probably damaging 1.00
R1634:Galnt12 UTSW 4 47108585 splice site probably null
R2072:Galnt12 UTSW 4 47108477 nonsense probably null
R2297:Galnt12 UTSW 4 47113834 missense probably damaging 1.00
R3113:Galnt12 UTSW 4 47108415 missense probably benign 0.01
R3157:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3159:Galnt12 UTSW 4 47104264 missense probably damaging 1.00
R3725:Galnt12 UTSW 4 47104140 missense probably damaging 1.00
R4284:Galnt12 UTSW 4 47104231 missense probably damaging 1.00
R4691:Galnt12 UTSW 4 47104143 missense probably damaging 1.00
R5134:Galnt12 UTSW 4 47113818 missense probably damaging 1.00
R5408:Galnt12 UTSW 4 47104169 missense probably damaging 1.00
R5657:Galnt12 UTSW 4 47104150 missense possibly damaging 0.95
R6074:Galnt12 UTSW 4 47112405 missense probably damaging 1.00
R6406:Galnt12 UTSW 4 47122534 missense probably benign 0.00
R6721:Galnt12 UTSW 4 47122529 nonsense probably null
R7287:Galnt12 UTSW 4 47108525 missense probably damaging 1.00
R7407:Galnt12 UTSW 4 47120362 missense probably damaging 1.00
R7512:Galnt12 UTSW 4 47108406 missense possibly damaging 0.83
X0025:Galnt12 UTSW 4 47104166 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTACAGGTGCAGAGAGG -3'
(R):5'- TGACCTCTTGATGACCCACCTG -3'

Sequencing Primer
(F):5'- GTGAAATACGATTATGATAACCTGCC -3'
(R):5'- CCTCTGAAGCTCTCTGGGTG -3'
Posted On2015-02-05