Incidental Mutation 'R3158:Sbk2'
ID263581
Institutional Source Beutler Lab
Gene Symbol Sbk2
Ensembl Gene ENSMUSG00000030433
Gene NameSH3-binding domain kinase family, member 2
SynonymsLOC381836
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4940512-4964406 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 4957527 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 215 (R215*)
Ref Sequence ENSEMBL: ENSMUSP00000138187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032598] [ENSMUST00000182214] [ENSMUST00000183170] [ENSMUST00000208109]
Predicted Effect probably null
Transcript: ENSMUST00000032598
AA Change: R215*
SMART Domains Protein: ENSMUSP00000032598
Gene: ENSMUSG00000030433
AA Change: R215*

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 2.8e-21 PFAM
Pfam:Pkinase 62 329 1.5e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182214
AA Change: R215*
SMART Domains Protein: ENSMUSP00000138504
Gene: ENSMUSG00000030433
AA Change: R215*

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 296 3.7e-21 PFAM
Pfam:Pkinase 62 329 6.8e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182837
Predicted Effect probably null
Transcript: ENSMUST00000183170
AA Change: R215*
SMART Domains Protein: ENSMUSP00000138187
Gene: ENSMUSG00000030433
AA Change: R215*

DomainStartEndE-ValueType
low complexity region 15 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 62 211 1.9e-18 PFAM
Pfam:Pkinase 62 212 3.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208109
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Sbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Sbk2 APN 7 4957529 missense probably damaging 1.00
IGL01595:Sbk2 APN 7 4957713 missense possibly damaging 0.86
IGL01688:Sbk2 APN 7 4957717 intron probably benign
IGL02901:Sbk2 APN 7 4957290 missense possibly damaging 0.66
IGL03392:Sbk2 APN 7 4957409 missense probably damaging 1.00
R1714:Sbk2 UTSW 7 4963122 missense probably benign 0.15
R2679:Sbk2 UTSW 7 4957120 splice site probably null
R4088:Sbk2 UTSW 7 4957628 missense probably damaging 1.00
R4709:Sbk2 UTSW 7 4957578 missense possibly damaging 0.79
R5211:Sbk2 UTSW 7 4962967 missense possibly damaging 0.89
R5906:Sbk2 UTSW 7 4957628 missense probably damaging 1.00
R6393:Sbk2 UTSW 7 4957622 missense probably damaging 1.00
R6967:Sbk2 UTSW 7 4964147 critical splice donor site probably null
R7045:Sbk2 UTSW 7 4958906 missense probably damaging 0.99
R7537:Sbk2 UTSW 7 4963149 missense probably benign 0.02
R7810:Sbk2 UTSW 7 4958939 missense probably damaging 1.00
R8058:Sbk2 UTSW 7 4957290 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGCCAGATGAGAAAGTCCTCAAAG -3'
(R):5'- GGGGAGCAGTGTCTTTCATC -3'

Sequencing Primer
(F):5'- GTCCTCAAAGAAAGGGTCAACC -3'
(R):5'- GGGAGCAGTGTCTTTCATCATCTC -3'
Posted On2015-02-05