Incidental Mutation 'R3158:Vmn2r37'
ID263582
Institutional Source Beutler Lab
Gene Symbol Vmn2r37
Ensembl Gene ENSMUSG00000066828
Gene Namevomeronasal 2, receptor 37
SynonymsV2r14
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R3158 (G1)
Quality Score112
Status Not validated
Chromosome7
Chromosomal Location9205546-9223653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9217714 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 383 (M383I)
Ref Sequence ENSEMBL: ENSMUSP00000072566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072787]
Predicted Effect probably benign
Transcript: ENSMUST00000072787
AA Change: M383I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072566
Gene: ENSMUSG00000066828
AA Change: M383I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 157 469 2.9e-26 PFAM
Pfam:NCD3G 512 563 1.1e-16 PFAM
Pfam:7tm_3 550 783 1.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Other mutations in Vmn2r37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Vmn2r37 APN 7 9206681 missense probably benign 0.05
IGL01909:Vmn2r37 APN 7 9216033 nonsense probably null
IGL02281:Vmn2r37 APN 7 9217882 missense possibly damaging 0.95
IGL02282:Vmn2r37 APN 7 9206762 missense probably benign 0.19
IGL02513:Vmn2r37 APN 7 9217935 missense probably benign 0.14
R0136:Vmn2r37 UTSW 7 9217783 nonsense probably null
R2051:Vmn2r37 UTSW 7 9217793 missense probably damaging 1.00
R2262:Vmn2r37 UTSW 7 9217944 missense probably damaging 0.99
R4084:Vmn2r37 UTSW 7 9215985 missense probably benign
R4114:Vmn2r37 UTSW 7 9210093 critical splice acceptor site probably null
R5231:Vmn2r37 UTSW 7 9206595 missense possibly damaging 0.94
R5462:Vmn2r37 UTSW 7 9217974 missense probably damaging 1.00
R6437:Vmn2r37 UTSW 7 9217851 missense probably damaging 0.98
R7104:Vmn2r37 UTSW 7 9216046 missense probably damaging 1.00
R7116:Vmn2r37 UTSW 7 9217899 missense probably benign 0.00
R7381:Vmn2r37 UTSW 7 9210033 missense probably benign 0.21
R8775:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8775-TAIL:Vmn2r37 UTSW 7 9215992 nonsense probably null
R8869:Vmn2r37 UTSW 7 9206855 missense possibly damaging 0.50
R8884:Vmn2r37 UTSW 7 9215917 missense probably benign
RF004:Vmn2r37 UTSW 7 9217687 missense probably damaging 0.97
Z1177:Vmn2r37 UTSW 7 9209997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCATCTGAAAGACTCTAAACAAC -3'
(R):5'- CCCCACCATGGTGTGATTTC -3'

Sequencing Primer
(F):5'- GACTCTAAACAACTATGCAAGTGAAG -3'
(R):5'- CAGACATGGTTCCATCTCAG -3'
Posted On2015-02-05