Incidental Mutation 'R3158:Dll3'
ID263584
Institutional Source Beutler Lab
Gene Symbol Dll3
Ensembl Gene ENSMUSG00000003436
Gene Namedelta like canonical Notch ligand 3
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28293553-28302238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28294095 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 566 (D566E)
Ref Sequence ENSEMBL: ENSMUSP00000103951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056589] [ENSMUST00000108315]
Predicted Effect probably benign
Transcript: ENSMUST00000056589
SMART Domains Protein: ENSMUSP00000050372
Gene: ENSMUSG00000046750

DomainStartEndE-ValueType
low complexity region 58 98 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
Pfam:Rdx 246 324 4.2e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108315
AA Change: D566E

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103951
Gene: ENSMUSG00000003436
AA Change: D566E

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 60 118 3e-18 BLAST
low complexity region 140 154 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
EGF 211 247 1.53e1 SMART
EGF 275 308 3.08e-6 SMART
EGF 313 349 8.25e-7 SMART
EGF 354 387 2.83e-5 SMART
EGF 392 425 1.04e-3 SMART
EGF 430 463 7.07e-6 SMART
transmembrane domain 489 511 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145512
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, a shortened body and tail, delayed and abnormal somite formation, a kinked neural tube, disorganized PNS elements, and severe axial skeletal dysplasia, including disorganized vertebrae and ribs defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Dll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0024:Dll3 UTSW 7 28300161 splice site probably benign
R0138:Dll3 UTSW 7 28301321 missense possibly damaging 0.88
R0322:Dll3 UTSW 7 28296368 missense possibly damaging 0.88
R0479:Dll3 UTSW 7 28301549 missense probably damaging 1.00
R1711:Dll3 UTSW 7 28294497 missense probably damaging 0.98
R1742:Dll3 UTSW 7 28294423 missense probably benign 0.37
R1854:Dll3 UTSW 7 28296410 missense probably damaging 1.00
R1920:Dll3 UTSW 7 28298923 missense probably benign
R3037:Dll3 UTSW 7 28299117 missense probably damaging 0.99
R4306:Dll3 UTSW 7 28301657 splice site probably null
R4424:Dll3 UTSW 7 28296291 missense probably damaging 1.00
R4873:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R4875:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R5604:Dll3 UTSW 7 28294632 missense probably benign
R5770:Dll3 UTSW 7 28299009 missense possibly damaging 0.84
R5988:Dll3 UTSW 7 28294112 missense probably damaging 0.98
R7204:Dll3 UTSW 7 28298905 missense possibly damaging 0.95
R7347:Dll3 UTSW 7 28299111 missense probably damaging 0.99
R7373:Dll3 UTSW 7 28294632 missense probably benign
R7694:Dll3 UTSW 7 28301745 start codon destroyed probably null 0.83
R7829:Dll3 UTSW 7 28294650 missense probably damaging 0.99
R7905:Dll3 UTSW 7 28301535 missense possibly damaging 0.61
R8681:Dll3 UTSW 7 28294845 missense probably damaging 0.99
Z1177:Dll3 UTSW 7 28301383 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCAGGCGATGATAGAGAAG -3'
(R):5'- CTTACCCAGGTGTTCTAGCC -3'

Sequencing Primer
(F):5'- AAGGGGCAGGATCAGGC -3'
(R):5'- AGGTGTTCTAGCCCTAGCC -3'
Posted On2015-02-05