Incidental Mutation 'R3158:Itga11'
Institutional Source Beutler Lab
Gene Symbol Itga11
Ensembl Gene ENSMUSG00000032243
Gene Nameintegrin alpha 11
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3158 (G1)
Quality Score147
Status Validated
Chromosomal Location62677826-62783982 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62769278 bp
Amino Acid Change Lysine to Arginine at position 916 (K916R)
Ref Sequence ENSEMBL: ENSMUSP00000034774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034774]
Predicted Effect probably benign
Transcript: ENSMUST00000034774
AA Change: K916R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000034774
Gene: ENSMUSG00000032243
AA Change: K916R

Int_alpha 37 90 3.9e-7 SMART
VWA 162 350 2.74e-38 SMART
Int_alpha 421 472 2.19e-1 SMART
Int_alpha 476 532 3.75e-9 SMART
Int_alpha 538 593 1.39e-12 SMART
Int_alpha 600 654 1.08e0 SMART
transmembrane domain 1142 1164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159012
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein contains an I domain, is expressed in muscle tissue, dimerizes with beta 1 integrin in vitro, and appears to bind collagen in this form. Therefore, the protein may be involved in attaching muscle tissue to the extracellular matrix. Alternative transcriptional splice variants have been found for this gene, but their biological validity is not determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption of this gene display dwarfism, increased mortality with age, and defective incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Itga11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00933:Itga11 APN 9 62769305 missense possibly damaging 0.58
IGL01108:Itga11 APN 9 62757621 missense probably benign
IGL01348:Itga11 APN 9 62744579 missense possibly damaging 0.83
IGL01739:Itga11 APN 9 62774117 missense probably benign 0.03
IGL01918:Itga11 APN 9 62772996 missense probably benign 0.05
IGL02237:Itga11 APN 9 62755775 critical splice donor site probably null
IGL02418:Itga11 APN 9 62744632 missense probably benign 0.30
IGL02451:Itga11 APN 9 62735353 missense probably damaging 1.00
sneezy UTSW 9 62732109 missense probably damaging 1.00
PIT4812001:Itga11 UTSW 9 62732193 missense probably damaging 1.00
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0013:Itga11 UTSW 9 62776613 missense possibly damaging 0.89
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0032:Itga11 UTSW 9 62774095 missense probably benign 0.05
R0101:Itga11 UTSW 9 62744486 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62735293 missense probably damaging 1.00
R0114:Itga11 UTSW 9 62760302 missense possibly damaging 0.85
R0212:Itga11 UTSW 9 62745969 missense probably benign 0.22
R0310:Itga11 UTSW 9 62760346 missense probably damaging 1.00
R0455:Itga11 UTSW 9 62696961 missense probably damaging 1.00
R0558:Itga11 UTSW 9 62752288 missense probably benign 0.01
R0607:Itga11 UTSW 9 62774371 missense probably benign 0.00
R0924:Itga11 UTSW 9 62776674 missense probably benign 0.14
R1085:Itga11 UTSW 9 62677970 missense probably benign 0.03
R1477:Itga11 UTSW 9 62755211 missense probably benign
R1647:Itga11 UTSW 9 62760370 missense probably benign 0.01
R1831:Itga11 UTSW 9 62782018 missense probably damaging 1.00
R1880:Itga11 UTSW 9 62677949 missense probably benign 0.06
R1934:Itga11 UTSW 9 62744514 missense probably damaging 1.00
R2025:Itga11 UTSW 9 62762811 missense probably damaging 1.00
R2046:Itga11 UTSW 9 62727697 missense probably damaging 1.00
R2145:Itga11 UTSW 9 62732204 splice site probably benign
R2922:Itga11 UTSW 9 62768630 splice site probably benign
R3011:Itga11 UTSW 9 62696980 missense probably damaging 0.99
R3809:Itga11 UTSW 9 62771382 missense probably benign
R3836:Itga11 UTSW 9 62769283 missense probably benign 0.00
R4051:Itga11 UTSW 9 62755651 nonsense probably null
R4190:Itga11 UTSW 9 62732109 missense probably damaging 1.00
R4510:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4511:Itga11 UTSW 9 62761588 missense probably damaging 0.96
R4678:Itga11 UTSW 9 62735357 missense probably damaging 0.98
R4706:Itga11 UTSW 9 62755296 missense possibly damaging 0.64
R4713:Itga11 UTSW 9 62765788 missense probably damaging 1.00
R4798:Itga11 UTSW 9 62776727 splice site probably null
R4909:Itga11 UTSW 9 62755299 missense probably damaging 1.00
R4915:Itga11 UTSW 9 62752248 nonsense probably null
R4957:Itga11 UTSW 9 62767648 missense probably benign 0.00
R4962:Itga11 UTSW 9 62761568 nonsense probably null
R5081:Itga11 UTSW 9 62755196 missense probably benign 0.13
R5265:Itga11 UTSW 9 62737412 missense probably benign 0.05
R5308:Itga11 UTSW 9 62755769 missense probably benign
R5398:Itga11 UTSW 9 62745923 missense probably benign 0.21
R5717:Itga11 UTSW 9 62752249 missense probably benign 0.26
R5885:Itga11 UTSW 9 62762850 missense probably damaging 0.99
R5996:Itga11 UTSW 9 62755673 missense probably benign 0.01
R6394:Itga11 UTSW 9 62735266 splice site probably null
R6751:Itga11 UTSW 9 62768584 missense probably benign 0.02
R7041:Itga11 UTSW 9 62752256 missense probably damaging 1.00
R7264:Itga11 UTSW 9 62745908 missense probably benign 0.02
R7509:Itga11 UTSW 9 62781940 missense probably benign
R7601:Itga11 UTSW 9 62696926 missense probably benign 0.18
R7615:Itga11 UTSW 9 62744018 missense probably benign 0.00
R8263:Itga11 UTSW 9 62696980 missense possibly damaging 0.86
R8285:Itga11 UTSW 9 62752258 missense probably damaging 1.00
R8419:Itga11 UTSW 9 62755178 missense possibly damaging 0.59
R8422:Itga11 UTSW 9 62767678 missense probably benign 0.00
R8469:Itga11 UTSW 9 62771398 missense probably benign 0.00
R8475:Itga11 UTSW 9 62744045 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-02-05