Incidental Mutation 'R3158:Ccr4'
ID263587
Institutional Source Beutler Lab
Gene Symbol Ccr4
Ensembl Gene ENSMUSG00000047898
Gene Namechemokine (C-C motif) receptor 4
SynonymsCC CKR-4, Cmkbr4
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114490316-114504916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114492282 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 238 (N238K)
Ref Sequence ENSEMBL: ENSMUSP00000150002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054414] [ENSMUST00000215425] [ENSMUST00000215959]
Predicted Effect probably benign
Transcript: ENSMUST00000054414
AA Change: N238K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062677
Gene: ENSMUSG00000047898
AA Change: N238K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 50 319 2.9e-11 PFAM
Pfam:7tm_1 56 304 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215425
AA Change: N238K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215959
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased mortality, decreased tumor necrosis factor production, and decreased IL-1beta production following LPS administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Ccr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02625:Ccr4 APN 9 114492333 missense probably damaging 1.00
kentucky UTSW 9 114492646 missense probably damaging 1.00
P4748:Ccr4 UTSW 9 114492838 missense probably damaging 1.00
PIT4651001:Ccr4 UTSW 9 114492193 missense probably benign 0.08
R1117:Ccr4 UTSW 9 114492017 missense probably benign 0.00
R1542:Ccr4 UTSW 9 114492005 missense probably benign
R1954:Ccr4 UTSW 9 114492685 missense probably damaging 0.99
R2047:Ccr4 UTSW 9 114492565 missense probably damaging 1.00
R3157:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3159:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R4868:Ccr4 UTSW 9 114492833 missense probably benign
R5051:Ccr4 UTSW 9 114492646 missense probably damaging 1.00
R6102:Ccr4 UTSW 9 114496493 splice site probably null
R6475:Ccr4 UTSW 9 114492979 missense probably benign 0.00
R6661:Ccr4 UTSW 9 114495963 intron probably benign
R7241:Ccr4 UTSW 9 114492956 missense probably benign
R7394:Ccr4 UTSW 9 114491926 missense probably benign
Z1177:Ccr4 UTSW 9 114492839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCCAGGGTTTCTGTAGC -3'
(R):5'- TCATCACCAGCCTGATCACG -3'

Sequencing Primer
(F):5'- CCTGGATGGCGTAGTCTAGGTAC -3'
(R):5'- AGCCTGATCACGTGGTCAGTG -3'
Posted On2015-02-05