Incidental Mutation 'R3158:Mmp11'
ID263588
Institutional Source Beutler Lab
Gene Symbol Mmp11
Ensembl Gene ENSMUSG00000000901
Gene Namematrix metallopeptidase 11
SynonymsST3, stromelysin 3, Stmy3
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75923222-75936496 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 75927114 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000924] [ENSMUST00000000924] [ENSMUST00000000924] [ENSMUST00000120281] [ENSMUST00000120281] [ENSMUST00000120281] [ENSMUST00000132869] [ENSMUST00000219728]
Predicted Effect probably benign
Transcript: ENSMUST00000000924
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000924
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000000924
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120281
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120281
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120281
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133897
Predicted Effect probably benign
Transcript: ENSMUST00000152222
SMART Domains Protein: ENSMUSP00000116279
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
Blast:HX 2 26 1e-8 BLAST
HX 29 76 7.63e-11 SMART
HX 78 117 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219728
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of endopeptidases that are involved in remodeling extracellular matrix during, for example, embryonic development and tumor progression. The encoded protein undergoes post-translational proteolytic processing by furin endopeptidase to form an active enzyme. Subcutaneous introduction of cells expressing the encoded protein into nude mice results in increased tumor incidence. Mice lacking the encoded protein exhibit a decreased incidence of chemically-induced tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice exhibit a decreased incidence of DMBA-induced carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Mmp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Mmp11 APN 10 75926821 missense probably benign 0.00
IGL01690:Mmp11 APN 10 75926896 missense probably damaging 1.00
IGL01804:Mmp11 APN 10 75928470 missense probably benign
R0285:Mmp11 UTSW 10 75925668 missense probably damaging 1.00
R0491:Mmp11 UTSW 10 75926758 missense probably benign 0.04
R0541:Mmp11 UTSW 10 75926933 missense probably damaging 1.00
R1857:Mmp11 UTSW 10 75928357 missense probably benign 0.01
R2400:Mmp11 UTSW 10 75925510 missense probably benign 0.18
R2442:Mmp11 UTSW 10 75927245 missense probably benign 0.09
R3157:Mmp11 UTSW 10 75927114 unclassified probably benign
R3159:Mmp11 UTSW 10 75927114 unclassified probably benign
R4915:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R4917:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R5137:Mmp11 UTSW 10 75925456 missense probably damaging 1.00
R5848:Mmp11 UTSW 10 75927389 missense probably damaging 1.00
R6156:Mmp11 UTSW 10 75926491 missense probably damaging 1.00
R6313:Mmp11 UTSW 10 75923984 makesense probably null
R6569:Mmp11 UTSW 10 75927382 start gained probably benign
R6753:Mmp11 UTSW 10 75928374 missense probably damaging 1.00
R7027:Mmp11 UTSW 10 75932396 unclassified probably benign
R7146:Mmp11 UTSW 10 75928446 missense probably benign
R7163:Mmp11 UTSW 10 75926576 missense possibly damaging 0.64
R7797:Mmp11 UTSW 10 75923480 missense
Predicted Primers PCR Primer
(F):5'- GAACATGGCCAAATTCATGAGC -3'
(R):5'- ATGATCGACTTCGCCAGGTG -3'

Sequencing Primer
(F):5'- AATTCATGAGCCGCCACTTG -3'
(R):5'- GTCAGCAGCCTCTAACTGTG -3'
Posted On2015-02-05