Incidental Mutation 'R3158:Tle6'
ID263589
Institutional Source Beutler Lab
Gene Symbol Tle6
Ensembl Gene ENSMUSG00000034758
Gene Nametransducin-like enhancer of split 6
Synonyms1810057E06Rik, Grg6
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.293) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location81590904-81601073 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 81595204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072020] [ENSMUST00000072020] [ENSMUST00000127546] [ENSMUST00000135211] [ENSMUST00000142948] [ENSMUST00000142948] [ENSMUST00000146358] [ENSMUST00000151858] [ENSMUST00000146916]
Predicted Effect probably null
Transcript: ENSMUST00000072020
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000072020
SMART Domains Protein: ENSMUSP00000071905
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 283 320 9.6e-2 SMART
Blast:WD40 334 372 2e-12 BLAST
WD40 377 415 6.16e0 SMART
WD40 418 455 7.43e-1 SMART
Blast:WD40 460 496 4e-13 BLAST
WD40 499 538 1.43e0 SMART
WD40 541 578 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124724
Predicted Effect probably benign
Transcript: ENSMUST00000124854
SMART Domains Protein: ENSMUSP00000118334
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Blast:WD40 6 44 9e-20 BLAST
WD40 46 85 1.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127546
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129798
Predicted Effect probably benign
Transcript: ENSMUST00000131411
SMART Domains Protein: ENSMUSP00000114400
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
WD40 36 75 1.2e-2 SMART
WD40 76 116 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135008
Predicted Effect probably benign
Transcript: ENSMUST00000135211
SMART Domains Protein: ENSMUSP00000117453
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 122 3e-68 PFAM
low complexity region 133 160 N/A INTRINSIC
low complexity region 172 194 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
low complexity region 332 352 N/A INTRINSIC
WD40 436 473 5.6e-3 SMART
WD40 479 520 9.6e-2 SMART
WD40 525 564 1.88e-4 SMART
WD40 567 606 3.72e-8 SMART
Blast:WD40 609 647 8e-18 BLAST
WD40 649 688 1.2e-2 SMART
WD40 689 729 2.07e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137631
Predicted Effect probably null
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142948
SMART Domains Protein: ENSMUSP00000117287
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
WD40 273 310 9.6e-2 SMART
Blast:WD40 324 362 2e-12 BLAST
WD40 367 405 6.16e0 SMART
WD40 408 445 7.43e-1 SMART
Blast:WD40 450 486 4e-13 BLAST
WD40 489 528 1.43e0 SMART
WD40 531 568 2.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146239
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136254
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139135
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140433
Predicted Effect probably benign
Transcript: ENSMUST00000146358
SMART Domains Protein: ENSMUSP00000121125
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 64 2e-31 PFAM
Pfam:TLE_N 81 154 4.3e-34 PFAM
low complexity region 167 194 N/A INTRINSIC
low complexity region 206 228 N/A INTRINSIC
low complexity region 296 311 N/A INTRINSIC
low complexity region 366 386 N/A INTRINSIC
WD40 471 508 5.6e-3 SMART
WD40 514 555 9.6e-2 SMART
WD40 560 599 1.88e-4 SMART
WD40 602 641 3.72e-8 SMART
Blast:WD40 644 682 9e-18 BLAST
WD40 684 723 1.2e-2 SMART
WD40 724 764 2.07e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151858
SMART Domains Protein: ENSMUSP00000119945
Gene: ENSMUSG00000034758

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146916
SMART Domains Protein: ENSMUSP00000121173
Gene: ENSMUSG00000034771

DomainStartEndE-ValueType
Pfam:TLE_N 1 134 1.6e-75 PFAM
low complexity region 144 171 N/A INTRINSIC
low complexity region 183 205 N/A INTRINSIC
low complexity region 273 288 N/A INTRINSIC
low complexity region 343 363 N/A INTRINSIC
WD40 435 472 5.6e-3 SMART
WD40 478 519 9.6e-2 SMART
WD40 524 563 1.88e-4 SMART
WD40 566 605 3.72e-8 SMART
WD40 648 687 1.2e-2 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Groucho/ transducin-like Enhancer of split family of transcriptional co-repressors. The encoded protein is a component of the mammalian subcortical maternal complex, which is required for preimplantation development. In mouse, knock out of this gene results in cleavage-stage embryonic arrest resulting from defective cytoplasmic F-actin meshwork formation and asymmetric cell division. In human, an allelic variant in this gene is associated with preimplantation embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Tle6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tle6 APN 10 81594458 missense probably damaging 1.00
IGL02151:Tle6 APN 10 81598640 missense probably benign 0.01
IGL02724:Tle6 APN 10 81600064 nonsense probably null
R0420:Tle6 UTSW 10 81595311 unclassified probably benign
R0423:Tle6 UTSW 10 81598623 missense possibly damaging 0.95
R0589:Tle6 UTSW 10 81595419 unclassified probably benign
R0605:Tle6 UTSW 10 81594346 missense probably damaging 0.99
R1554:Tle6 UTSW 10 81595385 missense probably benign 0.05
R1860:Tle6 UTSW 10 81594329 missense probably damaging 1.00
R1863:Tle6 UTSW 10 81591921 missense possibly damaging 0.91
R1952:Tle6 UTSW 10 81595485 missense possibly damaging 0.82
R2139:Tle6 UTSW 10 81594034 missense probably damaging 0.99
R2337:Tle6 UTSW 10 81592656 splice site probably null
R2849:Tle6 UTSW 10 81594401 missense probably damaging 1.00
R3777:Tle6 UTSW 10 81596153 missense probably benign 0.23
R3778:Tle6 UTSW 10 81596153 missense probably benign 0.23
R4085:Tle6 UTSW 10 81594515 splice site probably null
R5058:Tle6 UTSW 10 81594238 missense possibly damaging 0.93
R5058:Tle6 UTSW 10 81595957 missense probably damaging 1.00
R5183:Tle6 UTSW 10 81592801 missense probably damaging 0.97
R6225:Tle6 UTSW 10 81592766 missense probably damaging 1.00
R6331:Tle6 UTSW 10 81595239 missense probably benign 0.00
R6514:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6515:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R6517:Tle6 UTSW 10 81591976 missense probably damaging 1.00
R7145:Tle6 UTSW 10 81600076 missense possibly damaging 0.66
R8070:Tle6 UTSW 10 81598642 missense possibly damaging 0.79
R8085:Tle6 UTSW 10 81595958 missense probably damaging 1.00
R8194:Tle6 UTSW 10 81591054 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTGAGACGTTCCTTCTTTAACC -3'
(R):5'- GATCAAGTCTCCCTCAGCTC -3'

Sequencing Primer
(F):5'- ACTTTCAACTGTGTAGGTCCCAGG -3'
(R):5'- GATCAAGTCTCCCTCAGCTCTTCTAG -3'
Posted On2015-02-05