Incidental Mutation 'R3158:Aoc2'
ID263592
Institutional Source Beutler Lab
Gene Symbol Aoc2
Ensembl Gene ENSMUSG00000078651
Gene Nameamine oxidase, copper containing 2 (retina-specific)
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.269) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101325063-101329702 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101329276 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 696 (N696I)
Ref Sequence ENSEMBL: ENSMUSP00000040255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017316] [ENSMUST00000041095] [ENSMUST00000103105] [ENSMUST00000107264]
Predicted Effect probably benign
Transcript: ENSMUST00000017316
SMART Domains Protein: ENSMUSP00000017316
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 23 109 4.3e-24 PFAM
Pfam:Cu_amine_oxidN3 126 226 1.4e-28 PFAM
Pfam:Cu_amine_oxid 251 444 4.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041095
AA Change: N696I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040255
Gene: ENSMUSG00000078651
AA Change: N696I

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 165 263 5.7e-22 PFAM
Pfam:Cu_amine_oxid 309 718 3.7e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103105
SMART Domains Protein: ENSMUSP00000099394
Gene: ENSMUSG00000019326

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 1.7e-29 PFAM
Pfam:Cu_amine_oxidN3 169 269 1.5e-31 PFAM
low complexity region 284 298 N/A INTRINSIC
Pfam:Cu_amine_oxid 314 721 5.3e-120 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107264
AA Change: N669I

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102885
Gene: ENSMUSG00000078651
AA Change: N669I

DomainStartEndE-ValueType
transmembrane domain 5 26 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 62 148 8.2e-24 PFAM
Pfam:Cu_amine_oxidN3 165 263 9.9e-20 PFAM
Pfam:Cu_amine_oxid 308 605 5.9e-86 PFAM
Pfam:Cu_amine_oxid 600 694 7.3e-26 PFAM
Meta Mutation Damage Score 0.7447 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Copper amine oxidases catalyze the oxidative conversion of amines to aldehydes and ammonia in the presence of copper and quinone cofactor. This gene shows high sequence similarity to copper amine oxidases from various species ranging from bacteria to mammals. The protein contains several conserved motifs including the active site of amine oxidases and the histidine residues that likely bind copper. It may be a critical modulator of signal transmission in retina, possibly by degrading the biogenic amines dopamine, histamine, and putrescine. This gene may be a candidate gene for hereditary ocular diseases. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Aoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01900:Aoc2 APN 11 101328823 missense probably damaging 1.00
IGL02340:Aoc2 APN 11 101326375 missense probably damaging 1.00
IGL02382:Aoc2 APN 11 101326672 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0063:Aoc2 UTSW 11 101326071 missense probably damaging 1.00
R0398:Aoc2 UTSW 11 101325553 missense possibly damaging 0.56
R1430:Aoc2 UTSW 11 101326495 missense probably damaging 1.00
R1681:Aoc2 UTSW 11 101325192 missense probably benign
R3157:Aoc2 UTSW 11 101329276 missense probably damaging 1.00
R4159:Aoc2 UTSW 11 101325296 missense probably damaging 0.98
R4747:Aoc2 UTSW 11 101328820 critical splice acceptor site probably null
R5120:Aoc2 UTSW 11 101325714 missense probably benign 0.00
R5902:Aoc2 UTSW 11 101329246 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6032:Aoc2 UTSW 11 101325801 missense probably damaging 1.00
R6317:Aoc2 UTSW 11 101325466 missense probably damaging 1.00
R6778:Aoc2 UTSW 11 101325361 missense probably damaging 0.99
R7323:Aoc2 UTSW 11 101328545 missense probably damaging 1.00
R7491:Aoc2 UTSW 11 101328377 missense probably benign 0.14
R7584:Aoc2 UTSW 11 101326179 missense possibly damaging 0.50
Z1176:Aoc2 UTSW 11 101326420 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGGGAAAGCCATCTCTTCC -3'
(R):5'- GCCTATAAGCCTTCATAGGAAAAGG -3'

Sequencing Primer
(F):5'- GGGAAAGCCATCTCTTCCTGATG -3'
(R):5'- CTTCATAGGAAAAGGAGGGTAAGTTG -3'
Posted On2015-02-05