Incidental Mutation 'R3158:Cep95'
ID263593
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Namecentrosomal protein 95
SynonymsF630025I20Rik, Ccdc45, 4732496G21Rik
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106789252-106819930 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 106809187 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000103068]
Predicted Effect probably benign
Transcript: ENSMUST00000018516
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103068
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133581
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106818217 missense probably damaging 0.98
IGL00988:Cep95 APN 11 106806394 missense probably benign 0.00
IGL01306:Cep95 APN 11 106813815 missense probably benign 0.00
IGL01995:Cep95 APN 11 106806371 missense probably damaging 1.00
IGL02541:Cep95 APN 11 106815581 missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106813815 missense probably benign 0.00
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0255:Cep95 UTSW 11 106811271 missense probably benign 0.10
R0427:Cep95 UTSW 11 106790752 missense probably benign 0.18
R0436:Cep95 UTSW 11 106818685 missense probably null 0.98
R0583:Cep95 UTSW 11 106814623 missense probably benign
R0831:Cep95 UTSW 11 106814704 missense probably benign 0.00
R1459:Cep95 UTSW 11 106817955 missense probably damaging 1.00
R1589:Cep95 UTSW 11 106800104 missense probably benign 0.00
R1627:Cep95 UTSW 11 106809705 missense probably damaging 1.00
R1768:Cep95 UTSW 11 106806351 nonsense probably null
R1914:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1915:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1928:Cep95 UTSW 11 106790728 unclassified probably benign
R2495:Cep95 UTSW 11 106809282 missense possibly damaging 0.73
R3157:Cep95 UTSW 11 106809187 splice site probably benign
R3712:Cep95 UTSW 11 106811286 nonsense probably null
R3881:Cep95 UTSW 11 106806292 missense probably damaging 0.98
R4739:Cep95 UTSW 11 106815734 missense probably benign 0.34
R4908:Cep95 UTSW 11 106811346 missense probably damaging 1.00
R4989:Cep95 UTSW 11 106816654 splice site probably null
R5913:Cep95 UTSW 11 106818509 unclassified probably benign
R5925:Cep95 UTSW 11 106812401 missense probably benign 0.00
R6291:Cep95 UTSW 11 106815596 missense probably damaging 1.00
R6540:Cep95 UTSW 11 106801502 missense probably damaging 0.97
R6924:Cep95 UTSW 11 106811197 missense probably damaging 0.99
R6985:Cep95 UTSW 11 106818703 missense probably damaging 0.99
R7156:Cep95 UTSW 11 106809224 missense possibly damaging 0.84
R7940:Cep95 UTSW 11 106796148 missense probably benign
R8348:Cep95 UTSW 11 106813767 missense possibly damaging 0.81
R8509:Cep95 UTSW 11 106805050 missense probably benign 0.08
R8849:Cep95 UTSW 11 106816804 missense
X0028:Cep95 UTSW 11 106812410 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCCTATAAGGTTAAGAGAGAAGC -3'
(R):5'- GAGTGACTTGCCACCGTTAC -3'

Sequencing Primer
(F):5'- TTCTGGACAGTCTCTGCT -3'
(R):5'- GCAAGCACCTTTACCCTAAGTG -3'
Posted On2015-02-05