Incidental Mutation 'R3158:Cd300e'
ID263594
Institutional Source Beutler Lab
Gene Symbol Cd300e
Ensembl Gene ENSMUSG00000048498
Gene NameCD300E molecule
SynonymsCd300le, Trem5, Clm2
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115051917-115062177 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to C at 115062023 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 1 (M1R)
Ref Sequence ENSEMBL: ENSMUSP00000054883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062787]
Predicted Effect probably null
Transcript: ENSMUST00000062787
AA Change: M1R
SMART Domains Protein: ENSMUSP00000054883
Gene: ENSMUSG00000048498
AA Change: M1R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 21 128 6.26e-5 SMART
low complexity region 129 144 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.9150 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the CD300 glycoprotein family of cell surface proteins expressed on myeloid cells. The protein interacts with the TYRO protein tyrosine kinase-binding protein and is thought to act as an activating receptor. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Cd300e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3158_Cd300e_594 UTSW 11 115062023 start codon destroyed probably null
PIT4472001:Cd300e UTSW 11 115054510 missense possibly damaging 0.83
R1234:Cd300e UTSW 11 115055366 missense probably damaging 0.96
R1772:Cd300e UTSW 11 115054518 missense probably benign 0.21
R3157:Cd300e UTSW 11 115062023 start codon destroyed probably null
R6191:Cd300e UTSW 11 115054533 missense possibly damaging 0.92
R6283:Cd300e UTSW 11 115054554 missense probably benign 0.04
R7406:Cd300e UTSW 11 115055302 missense probably damaging 1.00
X0060:Cd300e UTSW 11 115055492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTGAATGCATGTATGTTCCC -3'
(R):5'- TTATTGAGTGCAGGCCCGTG -3'

Sequencing Primer
(F):5'- GAATGCATGTATGTTCCCCCTGC -3'
(R):5'- ACACATCTGGATTCCAGC -3'
Posted On2015-02-05