Incidental Mutation 'R3158:Sectm1a'
ID263595
Institutional Source Beutler Lab
Gene Symbol Sectm1a
Ensembl Gene ENSMUSG00000025165
Gene Namesecreted and transmembrane 1A
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location121067407-121081220 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121068777 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 175 (I175T)
Ref Sequence ENSEMBL: ENSMUSP00000026162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026162] [ENSMUST00000100126] [ENSMUST00000106119] [ENSMUST00000106120]
Predicted Effect probably benign
Transcript: ENSMUST00000026162
AA Change: I175T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026162
Gene: ENSMUSG00000025165
AA Change: I175T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Blast:IG 39 133 2e-64 BLAST
SCOP:d1biha2 42 114 3e-3 SMART
transmembrane domain 165 187 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100126
SMART Domains Protein: ENSMUSP00000097702
Gene: ENSMUSG00000025165

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106119
AA Change: I72T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101725
Gene: ENSMUSG00000025165
AA Change: I72T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
transmembrane domain 62 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106120
AA Change: I157T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101726
Gene: ENSMUSG00000025165
AA Change: I157T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Blast:IG 39 133 2e-64 BLAST
SCOP:d1biha2 42 114 2e-3 SMART
transmembrane domain 147 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149917
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane and secreted protein with characteristics of a type 1a transmembrane protein. It is found in a perinuclear Golgi-like pattern and thought to be involved in hematopoietic and/or immune system processes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Sectm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01664:Sectm1a APN 11 121069044 missense possibly damaging 0.55
R0571:Sectm1a UTSW 11 121069102 intron probably benign
R1987:Sectm1a UTSW 11 121069680 missense probably damaging 1.00
R2023:Sectm1a UTSW 11 121069582 splice site probably benign
R3157:Sectm1a UTSW 11 121068777 missense probably benign 0.19
R4463:Sectm1a UTSW 11 121069651 missense probably benign
R4664:Sectm1a UTSW 11 121069726 missense possibly damaging 0.76
R7241:Sectm1a UTSW 11 121069882 missense possibly damaging 0.46
R7418:Sectm1a UTSW 11 121069293 splice site probably null
R7712:Sectm1a UTSW 11 121068805 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTTTGTGGCAGAACGCAGG -3'
(R):5'- AGGTTATGCATTCCAGCCG -3'

Sequencing Primer
(F):5'- GGCTCACCCCAAAGCAGTTG -3'
(R):5'- TGATGCCATGGAGCCGAG -3'
Posted On2015-02-05