Incidental Mutation 'R3158:E330034G19Rik'
ID263596
Institutional Source Beutler Lab
Gene Symbol E330034G19Rik
Ensembl Gene ENSMUSG00000038925
Gene NameRIKEN cDNA E330034G19 gene
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location24293214-24309966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24296897 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 84 (Y84F)
Ref Sequence ENSEMBL: ENSMUSP00000123912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161740] [ENSMUST00000162224] [ENSMUST00000163055]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041413
AA Change: Y149F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040386
Gene: ENSMUSG00000038925
AA Change: Y149F

DomainStartEndE-ValueType
coiled coil region 78 131 N/A INTRINSIC
low complexity region 154 172 N/A INTRINSIC
coiled coil region 207 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160710
SMART Domains Protein: ENSMUSP00000125673
Gene: ENSMUSG00000038925

DomainStartEndE-ValueType
coiled coil region 96 149 N/A INTRINSIC
low complexity region 172 190 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161740
AA Change: Y149F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124917
Gene: ENSMUSG00000038925
AA Change: Y149F

DomainStartEndE-ValueType
coiled coil region 100 153 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
coiled coil region 229 347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162224
AA Change: Y84F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124926
Gene: ENSMUSG00000038925
AA Change: Y84F

DomainStartEndE-ValueType
coiled coil region 13 66 N/A INTRINSIC
low complexity region 89 107 N/A INTRINSIC
coiled coil region 136 256 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000163055
AA Change: Y84F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123912
Gene: ENSMUSG00000038925
AA Change: Y84F

DomainStartEndE-ValueType
coiled coil region 13 66 N/A INTRINSIC
low complexity region 89 107 N/A INTRINSIC
coiled coil region 142 181 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in E330034G19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02515:E330034G19Rik APN 14 24297984 missense possibly damaging 0.89
R0565:E330034G19Rik UTSW 14 24306917 missense probably benign 0.27
R1507:E330034G19Rik UTSW 14 24306987 missense possibly damaging 0.46
R1819:E330034G19Rik UTSW 14 24298013 missense probably damaging 0.99
R3966:E330034G19Rik UTSW 14 24306871 missense unknown
R4621:E330034G19Rik UTSW 14 24296002 utr 5 prime probably benign
R4992:E330034G19Rik UTSW 14 24306996 missense unknown
R5567:E330034G19Rik UTSW 14 24296824 missense possibly damaging 0.94
R5570:E330034G19Rik UTSW 14 24296824 missense possibly damaging 0.94
R5630:E330034G19Rik UTSW 14 24308268 unclassified probably benign
R6062:E330034G19Rik UTSW 14 24293380 intron probably benign
R6550:E330034G19Rik UTSW 14 24296818 missense probably benign 0.12
R6799:E330034G19Rik UTSW 14 24296110 missense probably benign 0.03
R6831:E330034G19Rik UTSW 14 24296095 missense probably benign 0.16
R6920:E330034G19Rik UTSW 14 24308242 missense unknown
R7457:E330034G19Rik UTSW 14 24309514 missense unknown
R8097:E330034G19Rik UTSW 14 24306852 missense unknown
R8210:E330034G19Rik UTSW 14 24296036 missense
R8221:E330034G19Rik UTSW 14 24296067 splice site probably null
R8243:E330034G19Rik UTSW 14 24308292 missense
R8830:E330034G19Rik UTSW 14 24309508 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTGCAGGTGCTTACTATGCAG -3'
(R):5'- TTTCTCAAGAGACTAACGTCCCAG -3'

Sequencing Primer
(F):5'- CAGGTGCTTACTATGCAGAGTCTC -3'
(R):5'- CGTCCCAGAATAGACATAGACAGAG -3'
Posted On2015-02-05