Incidental Mutation 'R3158:Krt6a'
ID263602
Institutional Source Beutler Lab
Gene Symbol Krt6a
Ensembl Gene ENSMUSG00000058354
Gene Namekeratin 6A
SynonymsKrt2-6a, MK6a, mK6[a], Krt2-6c
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101689910-101694307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101691366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 437 (Y437C)
Ref Sequence ENSEMBL: ENSMUSP00000023788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023788]
Predicted Effect probably damaging
Transcript: ENSMUST00000023788
AA Change: Y437C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023788
Gene: ENSMUSG00000058354
AA Change: Y437C

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 4.1e-36 PFAM
Filament 151 464 7.2e-178 SMART
low complexity region 483 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196874
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230205
Meta Mutation Damage Score 0.9640 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation exhibit delayed wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Krt6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Krt6a APN 15 101692794 missense probably damaging 1.00
IGL00596:Krt6a APN 15 101694230 missense possibly damaging 0.53
PIT4468001:Krt6a UTSW 15 101693917 missense probably damaging 0.98
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0024:Krt6a UTSW 15 101690715 splice site probably benign
R0811:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0812:Krt6a UTSW 15 101692748 missense probably damaging 1.00
R0828:Krt6a UTSW 15 101693836 missense probably damaging 0.99
R0924:Krt6a UTSW 15 101690800 splice site probably benign
R1525:Krt6a UTSW 15 101694202 missense probably benign
R1591:Krt6a UTSW 15 101692357 splice site probably null
R1725:Krt6a UTSW 15 101692557 missense probably damaging 1.00
R1962:Krt6a UTSW 15 101691465 missense probably damaging 1.00
R2201:Krt6a UTSW 15 101693171 missense probably benign 0.41
R3024:Krt6a UTSW 15 101691289 missense probably benign 0.02
R5369:Krt6a UTSW 15 101692558 missense probably benign 0.06
R5637:Krt6a UTSW 15 101692279 missense probably benign 0.25
R6164:Krt6a UTSW 15 101692573 missense probably damaging 0.99
R6320:Krt6a UTSW 15 101692309 missense probably damaging 0.99
R6562:Krt6a UTSW 15 101691659 missense probably benign 0.36
R7267:Krt6a UTSW 15 101693854 missense probably benign 0.03
R7560:Krt6a UTSW 15 101690559 missense unknown
R7621:Krt6a UTSW 15 101691752 missense possibly damaging 0.92
R7671:Krt6a UTSW 15 101690543 missense unknown
R8017:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8019:Krt6a UTSW 15 101693869 missense probably damaging 1.00
R8318:Krt6a UTSW 15 101694247 start codon destroyed probably null 0.02
R8508:Krt6a UTSW 15 101692735 missense probably damaging 1.00
X0067:Krt6a UTSW 15 101693777 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAAGGGACTATTGTGGGCATAGTC -3'
(R):5'- TGCTCACCAGAAACCATGGTC -3'

Sequencing Primer
(F):5'- TGGGCATAGTCAGTGCTCC -3'
(R):5'- TCAGCCTCTGCAGAGATGTAC -3'
Posted On2015-02-05