Incidental Mutation 'R3158:Olfr1453'
ID263605
Institutional Source Beutler Lab
Gene Symbol Olfr1453
Ensembl Gene ENSMUSG00000094755
Gene Nameolfactory receptor 1453
SynonymsMOR202-6, GA_x6K02T2RE5P-3357666-3356743
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3158 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13027404-13028327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 13028047 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glycine at position 94 (A94G)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: A94G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: A94G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Meta Mutation Damage Score 0.0929 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Olfr1453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Olfr1453 APN 19 13027591 missense probably damaging 0.98
IGL01137:Olfr1453 APN 19 13028030 missense possibly damaging 0.52
IGL01894:Olfr1453 APN 19 13028285 missense probably damaging 1.00
IGL02579:Olfr1453 APN 19 13027528 missense probably damaging 0.99
PIT4418001:Olfr1453 UTSW 19 13027731 nonsense probably null
R0099:Olfr1453 UTSW 19 13027801 missense probably damaging 1.00
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0395:Olfr1453 UTSW 19 13028299 missense probably damaging 1.00
R0453:Olfr1453 UTSW 19 13027931 missense probably damaging 0.97
R0847:Olfr1453 UTSW 19 13027731 nonsense probably null
R1227:Olfr1453 UTSW 19 13027853 missense probably benign
R1823:Olfr1453 UTSW 19 13027817 missense probably benign 0.06
R2509:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2899:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2964:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R2965:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R3157:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3409:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3410:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3411:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3425:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R4018:Olfr1453 UTSW 19 13027825 missense probably benign
R4668:Olfr1453 UTSW 19 13028081 missense probably benign 0.00
R4805:Olfr1453 UTSW 19 13028297 missense probably benign 0.04
R5180:Olfr1453 UTSW 19 13027412 missense probably benign 0.01
R5391:Olfr1453 UTSW 19 13027786 missense probably damaging 1.00
R5557:Olfr1453 UTSW 19 13027640 missense probably benign 0.01
R5740:Olfr1453 UTSW 19 13027562 missense probably benign 0.24
R7472:Olfr1453 UTSW 19 13028075 missense probably benign
R7832:Olfr1453 UTSW 19 13027996 missense probably benign 0.02
R7970:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R8044:Olfr1453 UTSW 19 13027465 missense probably damaging 1.00
R8229:Olfr1453 UTSW 19 13028197 missense possibly damaging 0.55
R8474:Olfr1453 UTSW 19 13027993 missense probably damaging 1.00
R8951:Olfr1453 UTSW 19 13027463 missense
R8957:Olfr1453 UTSW 19 13027517 missense probably benign 0.03
Z1088:Olfr1453 UTSW 19 13028027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTCACAGAAGGAGAGACTTAATGC -3'
(R):5'- TCACCCTTATAGGAAATCTTGGGC -3'

Sequencing Primer
(F):5'- AGGAGAGACTTAATGCATCCATAG -3'
(R):5'- CCCTTATAGGAAATCTTGGGCTGATC -3'
Posted On2015-02-05