Incidental Mutation 'R3158:Med14'
ID263606
Institutional Source Beutler Lab
Gene Symbol Med14
Ensembl Gene ENSMUSG00000064127
Gene Namemediator complex subunit 14
SynonymsTrap170, LOC270579, Crsp2, ENSMUSG00000073278, ORF1, 9930001L01Rik
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R3158 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location12675369-12762073 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 12684091 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096495] [ENSMUST00000115481]
Predicted Effect probably benign
Transcript: ENSMUST00000096495
SMART Domains Protein: ENSMUSP00000094239
Gene: ENSMUSG00000064127

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
Pfam:Med14 55 244 6.7e-63 PFAM
low complexity region 608 621 N/A INTRINSIC
low complexity region 1005 1018 N/A INTRINSIC
low complexity region 1065 1086 N/A INTRINSIC
low complexity region 1346 1361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115481
SMART Domains Protein: ENSMUSP00000111143
Gene: ENSMUSG00000064127

DomainStartEndE-ValueType
low complexity region 366 379 N/A INTRINSIC
low complexity region 426 447 N/A INTRINSIC
low complexity region 707 722 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124053
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein contains a bipartite nuclear localization signal. This gene is known to escape chromosome X-inactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male chimeras hemizygous for a gene trapped allele appear normal at E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Med14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Med14 APN X 12746764 splice site probably benign
IGL00670:Med14 APN X 12754189 missense probably damaging 0.98
IGL00895:Med14 APN X 12680800 missense probably damaging 0.99
IGL02434:Med14 APN X 12745824 missense possibly damaging 0.89
IGL03064:Med14 APN X 12747503 missense probably benign 0.04
R0295:Med14 UTSW X 12685748 missense probably damaging 1.00
R2844:Med14 UTSW X 12683996 missense probably benign 0.01
R2860:Med14 UTSW X 12719697 missense probably benign
R2861:Med14 UTSW X 12719697 missense probably benign
R2862:Med14 UTSW X 12719697 missense probably benign
R3157:Med14 UTSW X 12684091 splice site probably benign
R3807:Med14 UTSW X 12687177 missense probably damaging 1.00
X0022:Med14 UTSW X 12687141 missense probably damaging 1.00
Z1088:Med14 UTSW X 12677606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAAAGTGAGTGAGCTAGACC -3'
(R):5'- TGCAGAGTAGCCCTTAGTCC -3'

Sequencing Primer
(F):5'- GTGAGCTAGACCATAAGTACTGTTC -3'
(R):5'- CCAGACCCTTCAGCTAAAAGTG -3'
Posted On2015-02-05