Incidental Mutation 'R0324:Deup1'
ID 26361
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Name deuterosome assembly protein 1
Synonyms 4933401K09Rik, Ccdc67
MMRRC Submission 038534-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0324 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 15471160-15539229 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15493829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 438 (R438W)
Ref Sequence ENSEMBL: ENSMUSP00000039912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]
AlphaFold Q7M6Y5
Predicted Effect probably benign
Transcript: ENSMUST00000045513
AA Change: R438W

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: R438W

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115592
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115593
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137164
Predicted Effect probably benign
Transcript: ENSMUST00000152377
SMART Domains Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,219,989 (GRCm39) L357S probably benign Het
1700129C05Rik C T 14: 59,380,256 (GRCm39) R14H probably damaging Het
Aatf A G 11: 84,402,965 (GRCm39) probably null Het
Abca13 T A 11: 9,247,669 (GRCm39) M2472K possibly damaging Het
Abcd3 C A 3: 121,562,816 (GRCm39) Q540H probably null Het
Adam17 C T 12: 21,399,939 (GRCm39) V156I probably benign Het
Adam26a A G 8: 44,021,490 (GRCm39) S667P probably benign Het
Adcy10 A G 1: 165,391,818 (GRCm39) K1333E probably benign Het
Apob G A 12: 8,060,521 (GRCm39) R2968Q probably benign Het
Arap3 G A 18: 38,106,278 (GRCm39) P1522S possibly damaging Het
Catsper1 A T 19: 5,386,573 (GRCm39) S269C probably damaging Het
Cd209d A T 8: 3,928,258 (GRCm39) S42R probably benign Het
Cntln T A 4: 85,010,932 (GRCm39) V1049E probably damaging Het
Cracr2b T C 7: 141,043,659 (GRCm39) F87L probably damaging Het
Crb3 T C 17: 57,372,133 (GRCm39) L60P probably damaging Het
Crispld1 T C 1: 17,819,815 (GRCm39) V271A probably benign Het
Cyp2c66 G T 19: 39,165,135 (GRCm39) R372L probably benign Het
Dnah6 C T 6: 73,150,541 (GRCm39) E741K possibly damaging Het
Epha4 T C 1: 77,360,188 (GRCm39) E703G probably damaging Het
Evc2 G A 5: 37,550,443 (GRCm39) R819H probably damaging Het
Fam217a A C 13: 35,094,944 (GRCm39) C272G possibly damaging Het
Fndc7 T C 3: 108,784,015 (GRCm39) probably null Het
Foxs1 C T 2: 152,774,607 (GRCm39) G149S probably benign Het
Galnt13 T C 2: 54,744,628 (GRCm39) V109A probably benign Het
Hmgxb4 G A 8: 75,725,556 (GRCm39) M7I probably benign Het
Klk1b1 T A 7: 43,620,165 (GRCm39) C209* probably null Het
Klra10 A G 6: 130,249,613 (GRCm39) probably null Het
Kntc1 A T 5: 123,916,175 (GRCm39) K701N probably damaging Het
Lpgat1 T A 1: 191,481,754 (GRCm39) L114Q probably damaging Het
Mecom T A 3: 30,017,261 (GRCm39) Q468L probably damaging Het
Med15 T C 16: 17,515,476 (GRCm39) T70A probably damaging Het
Msh6 T A 17: 88,294,048 (GRCm39) Y934* probably null Het
Mtus1 T C 8: 41,537,432 (GRCm39) T95A probably benign Het
Mylk3 C A 8: 86,079,535 (GRCm39) R444S probably damaging Het
Nbea A G 3: 55,965,369 (GRCm39) probably null Het
Nbeal1 T C 1: 60,332,032 (GRCm39) V2242A probably damaging Het
Nhp2 A G 11: 51,513,334 (GRCm39) T85A possibly damaging Het
Nlk A G 11: 78,463,257 (GRCm39) S413P possibly damaging Het
Nmbr A G 10: 14,636,192 (GRCm39) I54V possibly damaging Het
Nmur2 A T 11: 55,931,346 (GRCm39) C122S probably damaging Het
Nudt13 G T 14: 20,361,583 (GRCm39) V220L probably damaging Het
Or5m13 G A 2: 85,748,295 (GRCm39) V9M probably benign Het
Pclo G A 5: 14,719,447 (GRCm39) G1195R unknown Het
Pcsk7 A G 9: 45,824,309 (GRCm39) H276R possibly damaging Het
Pdss2 T C 10: 43,269,924 (GRCm39) S256P probably damaging Het
Pgf G T 12: 85,218,198 (GRCm39) H116N probably benign Het
Pglyrp2 T C 17: 32,637,302 (GRCm39) D242G probably benign Het
Plk2 G A 13: 110,534,242 (GRCm39) R274K probably benign Het
Ppp6r3 G T 19: 3,514,693 (GRCm39) P141T probably benign Het
Prss54 T C 8: 96,292,295 (GRCm39) T95A probably benign Het
Rab3il1 A G 19: 10,005,653 (GRCm39) D149G probably damaging Het
Rasgef1c T C 11: 49,852,057 (GRCm39) probably null Het
Rhpn1 T C 15: 75,583,437 (GRCm39) M334T probably damaging Het
Rigi T C 4: 40,213,766 (GRCm39) T586A probably benign Het
Robo2 C T 16: 73,764,739 (GRCm39) V630M probably damaging Het
Rptor C T 11: 119,783,467 (GRCm39) R1154W probably damaging Het
Scnn1g A G 7: 121,339,778 (GRCm39) I192M possibly damaging Het
Sit1 G A 4: 43,482,815 (GRCm39) Q115* probably null Het
Slc13a2 T C 11: 78,295,350 (GRCm39) N141S probably damaging Het
Slc19a2 C A 1: 164,084,344 (GRCm39) T78K probably damaging Het
Snx14 A G 9: 88,287,291 (GRCm39) probably null Het
Stil T A 4: 114,896,346 (GRCm39) C944S probably benign Het
Tex56 A G 13: 35,108,596 (GRCm39) N26S probably benign Het
Tnfaip2 A G 12: 111,419,893 (GRCm39) N675S probably damaging Het
Trim30c A G 7: 104,032,516 (GRCm39) I270T possibly damaging Het
Ugt2a3 C T 5: 87,474,932 (GRCm39) probably null Het
Vmn1r213 A T 13: 23,195,588 (GRCm39) probably benign Het
Vmn2r8 A C 5: 108,945,807 (GRCm39) probably null Het
Vps13c T C 9: 67,871,591 (GRCm39) F3253L possibly damaging Het
Zbtb16 G T 9: 48,576,575 (GRCm39) Q502K possibly damaging Het
Zfp143 A G 7: 109,676,354 (GRCm39) K218E possibly damaging Het
Zfp946 A G 17: 22,673,417 (GRCm39) N57S probably benign Het
Zfp985 T C 4: 147,667,314 (GRCm39) Y61H probably benign Het
Zkscan1 G A 5: 138,095,785 (GRCm39) R246Q probably damaging Het
Zpld1 A G 16: 55,071,978 (GRCm39) F94L probably damaging Het
Zswim5 G T 4: 116,844,103 (GRCm39) W1047L probably damaging Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15,472,666 (GRCm39) missense probably damaging 0.96
IGL00927:Deup1 APN 9 15,521,967 (GRCm39) splice site probably benign
IGL00946:Deup1 APN 9 15,472,534 (GRCm39) missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15,503,656 (GRCm39) missense probably benign 0.02
IGL02567:Deup1 APN 9 15,486,579 (GRCm39) missense probably damaging 1.00
IGL03089:Deup1 APN 9 15,519,096 (GRCm39) missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15,503,707 (GRCm39) missense probably benign 0.38
IGL03147:Deup1 UTSW 9 15,521,910 (GRCm39) missense probably damaging 0.99
PIT4468001:Deup1 UTSW 9 15,475,301 (GRCm39) missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15,511,117 (GRCm39) missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15,511,117 (GRCm39) missense possibly damaging 0.89
R0539:Deup1 UTSW 9 15,493,893 (GRCm39) missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15,511,047 (GRCm39) missense probably damaging 1.00
R1666:Deup1 UTSW 9 15,486,487 (GRCm39) missense possibly damaging 0.92
R2212:Deup1 UTSW 9 15,511,139 (GRCm39) missense probably benign 0.00
R2237:Deup1 UTSW 9 15,486,597 (GRCm39) missense probably damaging 1.00
R2238:Deup1 UTSW 9 15,486,597 (GRCm39) missense probably damaging 1.00
R2423:Deup1 UTSW 9 15,503,754 (GRCm39) nonsense probably null
R2929:Deup1 UTSW 9 15,486,484 (GRCm39) missense probably benign 0.03
R3890:Deup1 UTSW 9 15,511,009 (GRCm39) missense probably damaging 1.00
R3892:Deup1 UTSW 9 15,511,009 (GRCm39) missense probably damaging 1.00
R4941:Deup1 UTSW 9 15,499,323 (GRCm39) missense probably benign
R4959:Deup1 UTSW 9 15,523,310 (GRCm39) nonsense probably null
R4960:Deup1 UTSW 9 15,512,264 (GRCm39) missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15,503,724 (GRCm39) missense probably damaging 0.99
R4973:Deup1 UTSW 9 15,523,310 (GRCm39) nonsense probably null
R5195:Deup1 UTSW 9 15,486,487 (GRCm39) missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15,486,495 (GRCm39) missense probably damaging 0.96
R5470:Deup1 UTSW 9 15,493,916 (GRCm39) splice site probably null
R5931:Deup1 UTSW 9 15,472,618 (GRCm39) missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15,472,552 (GRCm39) missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15,472,638 (GRCm39) missense probably damaging 0.99
R6516:Deup1 UTSW 9 15,521,910 (GRCm39) missense probably damaging 0.99
R7948:Deup1 UTSW 9 15,521,944 (GRCm39) missense possibly damaging 0.76
R8373:Deup1 UTSW 9 15,503,671 (GRCm39) missense possibly damaging 0.80
R8725:Deup1 UTSW 9 15,503,721 (GRCm39) missense probably damaging 1.00
R9008:Deup1 UTSW 9 15,511,140 (GRCm39) missense probably damaging 0.99
R9462:Deup1 UTSW 9 15,493,882 (GRCm39) missense probably benign 0.04
R9545:Deup1 UTSW 9 15,519,120 (GRCm39) missense possibly damaging 0.95
Z1177:Deup1 UTSW 9 15,519,128 (GRCm39) missense probably benign 0.11
Z1177:Deup1 UTSW 9 15,512,199 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCATAAGGTTGGCACCGAATTCCG -3'
(R):5'- CCACAGGAAGTATTTGCACCACCTC -3'

Sequencing Primer
(F):5'- CCAGACAACATCATGCTTTGAGTG -3'
(R):5'- CACCTCAACGGGGTTTATTAAC -3'
Posted On 2013-04-16