Mutagenetix > Incidental Mutation

Incidental Mutation 'R3107:Clspn'

263614

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

040581-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3107 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126591659 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1247 (D1247G)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

probably benign
Transcript: ENSMUST00000048391
AA Change: D1247G

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: D1247G

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128202

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,723,447	L814H	probably damaging	Het
Adgrf4	A	T	17: 42,666,867	Y528*	probably null	Het
Ankrd26	A	T	6: 118,556,243	F198L	probably benign	Het
Arnt2	A	G	7: 84,262,444	S607P	possibly damaging	Het
Ccdc17	T	C	4: 116,598,267	V269A	probably benign	Het
Cers1	T	A	8: 70,322,636	H233Q	probably benign	Het
Cfap54	T	C	10: 92,994,683	N1197S	probably benign	Het
Cfb	A	G	17: 34,861,824	Y66H	possibly damaging	Het
Cnnm1	T	C	19: 43,441,561	C373R	probably damaging	Het
Col19a1	T	C	1: 24,337,936	T443A	possibly damaging	Het
Cubn	T	C	2: 13,362,347	S1571G	possibly damaging	Het
Ddt	C	T	10: 75,772,763	E42K	probably benign	Het
Dmrt2	C	A	19: 25,677,691	T218N	probably benign	Het
Dnah7b	G	A	1: 46,352,873	G3798E	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam114a2	C	A	11: 57,499,735	K317N	probably benign	Het
Fyn	G	C	10: 39,551,455	D445H	probably damaging	Het
Gprasp1	A	T	X: 135,799,759	M234L	probably benign	Het
Ibtk	T	C	9: 85,710,414	Y997C	probably damaging	Het
Il12rb2	A	G	6: 67,360,798	V33A	probably damaging	Het
Ints6	T	C	14: 62,760,592	T23A	possibly damaging	Het
Itk	C	A	11: 46,327,464	G624V	probably benign	Het
Lama2	C	T	10: 27,001,235	E2652K	probably benign	Het
Mab21l3	T	A	3: 101,826,796	I109F	probably damaging	Het
Mov10	T	C	3: 104,799,724	E653G	probably damaging	Het
Olfr916	C	T	9: 38,658,011	C127Y	possibly damaging	Het
Plg	T	C	17: 12,384,429	V74A	probably benign	Het
Ptprn2	A	G	12: 116,876,180	D441G	probably benign	Het
Rbmxl2	G	A	7: 107,210,417	G303E	probably damaging	Het
Satb1	A	T	17: 51,782,782	Y346N	possibly damaging	Het
Serpina1a	A	T	12: 103,853,841	I382N	probably damaging	Het
Slc6a2	C	A	8: 92,961,278	Q11K	probably benign	Het
Slc6a20a	A	C	9: 123,641,708		probably null	Het
Sorcs1	T	C	19: 50,210,650	E825G	possibly damaging	Het
Sval1	C	G	6: 41,955,942	P145A	probably damaging	Het
Trhde	C	T	10: 114,592,066	E442K	probably damaging	Het
Vmn2r61	A	T	7: 42,267,067	D368V	possibly damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGGAAATGCATCCCCTCA -3'
(R):5'- CACCATAGCAGCTGTTAGATAAGAAT -3'

Sequencing Primer
(F):5'- TCAGTACCAGGGTCAGGGTG -3'
(R):5'- AGGCACTTACTCTTCTGGCAGAG -3'

Posted On

2015-02-05