Incidental Mutation 'R3107:Ankrd26'
ID263617
Institutional Source Beutler Lab
Gene Symbol Ankrd26
Ensembl Gene ENSMUSG00000007827
Gene Nameankyrin repeat domain 26
Synonyms5730521P14Rik
MMRRC Submission 040581-MU
Accession Numbers

Genbank: NM_001081112;MGI: 1917887

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location118501308-118562226 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118556243 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 198 (F198L)
Ref Sequence ENSEMBL: ENSMUSP00000108449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112830]
Predicted Effect probably benign
Transcript: ENSMUST00000112830
AA Change: F198L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000108449
Gene: ENSMUSG00000007827
AA Change: F198L

DomainStartEndE-ValueType
ANK 80 109 1.5e-7 SMART
ANK 113 142 3.5e-4 SMART
ANK 146 175 1.9e-6 SMART
ANK 179 208 2.2e-4 SMART
low complexity region 306 316 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Blast:BRLZ 692 754 4e-10 BLAST
Pfam:CCDC144C 886 1190 2e-142 PFAM
low complexity region 1298 1315 N/A INTRINSIC
low complexity region 1345 1357 N/A INTRINSIC
coiled coil region 1407 1444 N/A INTRINSIC
low complexity region 1473 1486 N/A INTRINSIC
Pfam:DUF3496 1495 1602 1.3e-47 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing N-terminal ankyrin repeats which function in protein-protein interactions. Mutations in this gene are associated with autosomal dominant thrombocytopenia-2. Pseudogenes of this gene are found on chromosome 7, 10, 13 and 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele have enlarged kidneys and hearts, exhibit increased lean body mass and adiposity, develop extreme obesity associated with hyperphagia rather than reduced energy expenditure, and show insulin resistance and gigantism. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Ankrd26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Ankrd26 APN 6 118559358 nonsense probably null
IGL01286:Ankrd26 APN 6 118559107 missense probably damaging 1.00
IGL01574:Ankrd26 APN 6 118539698 missense probably damaging 1.00
IGL01727:Ankrd26 APN 6 118511636 missense probably damaging 1.00
IGL01954:Ankrd26 APN 6 118559005 missense possibly damaging 0.62
IGL02200:Ankrd26 APN 6 118559341 missense probably damaging 1.00
IGL02708:Ankrd26 APN 6 118518418 splice site probably benign
IGL02973:Ankrd26 APN 6 118523550 missense probably damaging 0.98
IGL03233:Ankrd26 APN 6 118535146 splice site probably null
ANU74:Ankrd26 UTSW 6 118552775 missense probably benign 0.02
N/A:Ankrd26 UTSW 6 118529574 missense probably benign 0.04
R0078:Ankrd26 UTSW 6 118535069 splice site probably benign
R0083:Ankrd26 UTSW 6 118523254 missense probably benign 0.36
R0165:Ankrd26 UTSW 6 118540484 missense probably benign 0.01
R0344:Ankrd26 UTSW 6 118507637 critical splice donor site probably null
R0828:Ankrd26 UTSW 6 118533473 splice site probably benign
R1532:Ankrd26 UTSW 6 118522958 missense probably damaging 1.00
R1809:Ankrd26 UTSW 6 118525922 splice site probably benign
R1875:Ankrd26 UTSW 6 118540449 critical splice donor site probably null
R1940:Ankrd26 UTSW 6 118511693 missense probably damaging 1.00
R2164:Ankrd26 UTSW 6 118525791 missense probably damaging 1.00
R2202:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2204:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R2205:Ankrd26 UTSW 6 118523882 missense possibly damaging 0.79
R3419:Ankrd26 UTSW 6 118535107 missense probably damaging 1.00
R3552:Ankrd26 UTSW 6 118507776 missense probably damaging 1.00
R3899:Ankrd26 UTSW 6 118549428 missense probably benign 0.30
R4157:Ankrd26 UTSW 6 118507821 missense probably damaging 1.00
R4194:Ankrd26 UTSW 6 118523678 missense probably benign 0.21
R4230:Ankrd26 UTSW 6 118559388 splice site probably null
R4651:Ankrd26 UTSW 6 118515826 missense probably benign 0.03
R4701:Ankrd26 UTSW 6 118506485 missense possibly damaging 0.65
R4747:Ankrd26 UTSW 6 118527757 missense probably benign 0.01
R4752:Ankrd26 UTSW 6 118540465 missense probably null 1.00
R4834:Ankrd26 UTSW 6 118523718 missense probably benign 0.08
R4835:Ankrd26 UTSW 6 118548850 nonsense probably null
R4849:Ankrd26 UTSW 6 118532296 missense probably benign 0.00
R5149:Ankrd26 UTSW 6 118558996 missense probably benign 0.05
R5389:Ankrd26 UTSW 6 118508575 missense possibly damaging 0.82
R5473:Ankrd26 UTSW 6 118515836 missense probably benign 0.04
R5518:Ankrd26 UTSW 6 118548908 missense probably benign 0.00
R5525:Ankrd26 UTSW 6 118527731 missense probably benign 0.00
R5608:Ankrd26 UTSW 6 118511622 missense probably damaging 1.00
R5639:Ankrd26 UTSW 6 118539724 missense possibly damaging 0.72
R5704:Ankrd26 UTSW 6 118523882 missense probably damaging 0.96
R5927:Ankrd26 UTSW 6 118507636 critical splice donor site probably null
R5943:Ankrd26 UTSW 6 118505746 missense probably damaging 1.00
R5976:Ankrd26 UTSW 6 118517894 critical splice donor site probably null
R6181:Ankrd26 UTSW 6 118548877 missense probably benign 0.15
R6478:Ankrd26 UTSW 6 118511638 missense probably benign 0.28
R6667:Ankrd26 UTSW 6 118507788 missense probably benign 0.02
R6865:Ankrd26 UTSW 6 118523481 missense possibly damaging 0.90
R7224:Ankrd26 UTSW 6 118539727 missense probably benign 0.07
R7287:Ankrd26 UTSW 6 118549637 critical splice donor site probably null
R7301:Ankrd26 UTSW 6 118511663 missense possibly damaging 0.62
R7348:Ankrd26 UTSW 6 118508564 missense probably damaging 1.00
R7414:Ankrd26 UTSW 6 118508780 missense possibly damaging 0.60
R7789:Ankrd26 UTSW 6 118527798 missense probably damaging 0.98
R7789:Ankrd26 UTSW 6 118527799 missense possibly damaging 0.82
X0028:Ankrd26 UTSW 6 118507761 missense probably damaging 1.00
Z1177:Ankrd26 UTSW 6 118523532 missense possibly damaging 0.77
Z1177:Ankrd26 UTSW 6 118523595 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGAGTGTTTGTTATCACACCAG -3'
(R):5'- CAACTGCCTTCAAGAGATGC -3'

Sequencing Primer
(F):5'- CCAGTTAGCAAGCAAGCTCTTGG -3'
(R):5'- AAGAGATGCTTGACTGGGTG -3'
Posted On2015-02-05