Incidental Mutation 'R0324:Pcsk7'
ID26362
Institutional Source Beutler Lab
Gene Symbol Pcsk7
Ensembl Gene ENSMUSG00000035382
Gene Nameproprotein convertase subtilisin/kexin type 7
SynonymsSPC7
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location45906497-45929726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45913011 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 276 (H276R)
Ref Sequence ENSEMBL: ENSMUSP00000150393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039059] [ENSMUST00000213854] [ENSMUST00000215189] [ENSMUST00000216672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039059
AA Change: H276R

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047508
Gene: ENSMUSG00000035382
AA Change: H276R

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:S8_pro-domain 52 140 9.7e-21 PFAM
Pfam:Peptidase_S8 177 464 4.7e-43 PFAM
Pfam:P_proprotein 524 611 1.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213854
Predicted Effect possibly damaging
Transcript: ENSMUST00000215189
AA Change: H276R

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216672
AA Change: H276R

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. It encodes a type 1 membrane bound protease that is expressed in many tissues, including neuroendocrine, liver, gut, and brain. The encoded protein undergoes an initial autocatalytic processing event in the ER and then sorts to the trans-Golgi network through endosomes where a second autocatalytic event takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It can process proalbumin and is thought to be responsible for the activation of HIV envelope glycoproteins gp160 and gp140. This gene has been implicated in the transcriptional regulation of housekeeping genes and plays a role in the regulation of iron metabolism. A t(11;14)(q23;q32) chromosome translocation associated with B-cell lymphoma occurs between this gene and its inverted counterpart. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal response to LPS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Pcsk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Pcsk7 APN 9 45927660 missense probably benign
IGL01081:Pcsk7 APN 9 45928707 missense probably benign
IGL02634:Pcsk7 APN 9 45919262 missense possibly damaging 0.87
IGL02999:Pcsk7 APN 9 45927599 missense possibly damaging 0.68
IGL03115:Pcsk7 APN 9 45914372 missense probably damaging 1.00
IGL03149:Pcsk7 APN 9 45909480 missense probably benign 0.37
R0243:Pcsk7 UTSW 9 45916059 missense probably damaging 1.00
R0947:Pcsk7 UTSW 9 45911172 missense probably damaging 1.00
R1443:Pcsk7 UTSW 9 45925986 missense probably damaging 1.00
R1545:Pcsk7 UTSW 9 45914348 missense probably damaging 1.00
R2182:Pcsk7 UTSW 9 45928619 missense probably benign
R2939:Pcsk7 UTSW 9 45916024 missense probably damaging 1.00
R3739:Pcsk7 UTSW 9 45926759 missense possibly damaging 0.72
R4039:Pcsk7 UTSW 9 45928007 splice site probably null
R4348:Pcsk7 UTSW 9 45919348 missense probably damaging 1.00
R4974:Pcsk7 UTSW 9 45918862 missense probably damaging 1.00
R5817:Pcsk7 UTSW 9 45926033 missense probably benign 0.01
R6214:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6215:Pcsk7 UTSW 9 45910376 missense possibly damaging 0.47
R6408:Pcsk7 UTSW 9 45909696 missense probably benign 0.18
R7338:Pcsk7 UTSW 9 45925989 missense probably benign 0.03
R7355:Pcsk7 UTSW 9 45909374 missense probably benign 0.03
R7475:Pcsk7 UTSW 9 45927625 missense probably damaging 1.00
R7540:Pcsk7 UTSW 9 45927673 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACCTGGCACCCTACTTGGGGAATG -3'
(R):5'- TGACAGGGGCCATCCACCTTAAAC -3'

Sequencing Primer
(F):5'- TGCTGGATGGACCACTTACT -3'
(R):5'- TTGTGGCAAGTCTAAGACCC -3'
Posted On2013-04-16