Incidental Mutation 'R3107:Olfr916'
ID 263623
Institutional Source Beutler Lab
Gene Symbol Olfr916
Ensembl Gene ENSMUSG00000094701
Gene Name olfactory receptor 916
Synonyms GA_x6K02T2PVTD-32360710-32359778, MOR168-1
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.405) question?
Stock # R3107 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38655052-38659875 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 38658011 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 127 (C127Y)
Ref Sequence ENSEMBL: ENSMUSP00000149578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081196] [ENSMUST00000213714] [ENSMUST00000214093] [ENSMUST00000215291]
AlphaFold Q8VG53
Predicted Effect possibly damaging
Transcript: ENSMUST00000081196
AA Change: C127Y

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000079959
Gene: ENSMUSG00000094701
AA Change: C127Y

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-45 PFAM
Pfam:7tm_1 41 290 1.3e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213714
AA Change: C127Y

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214093
AA Change: C127Y

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000215291
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217596
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Olfr916
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01965:Olfr916 APN 9 38657622 missense probably benign 0.00
IGL02313:Olfr916 APN 9 38658066 missense probably damaging 0.97
IGL03221:Olfr916 APN 9 38658365 missense probably damaging 0.99
R0479:Olfr916 UTSW 9 38658182 missense probably damaging 1.00
R1507:Olfr916 UTSW 9 38658014 missense probably damaging 1.00
R1521:Olfr916 UTSW 9 38657718 missense probably damaging 0.99
R1860:Olfr916 UTSW 9 38658365 missense probably damaging 0.99
R3964:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R3965:Olfr916 UTSW 9 38657727 missense probably benign 0.42
R4419:Olfr916 UTSW 9 38658069 missense probably benign 0.01
R5249:Olfr916 UTSW 9 38658078 missense possibly damaging 0.88
R5481:Olfr916 UTSW 9 38657620 missense probably benign 0.00
R6299:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6555:Olfr916 UTSW 9 38658289 missense probably benign 0.00
R6702:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6703:Olfr916 UTSW 9 38657777 missense possibly damaging 0.94
R6851:Olfr916 UTSW 9 38658185 missense probably benign 0.31
R6895:Olfr916 UTSW 9 38658089 missense probably damaging 0.97
R8688:Olfr916 UTSW 9 38657751 missense probably benign 0.24
R8985:Olfr916 UTSW 9 38658325 nonsense probably null
R9259:Olfr916 UTSW 9 38658346 splice site probably benign
R9292:Olfr916 UTSW 9 38657775 missense probably damaging 1.00
R9634:Olfr916 UTSW 9 38657573 missense probably benign 0.06
R9641:Olfr916 UTSW 9 38657619 missense probably benign 0.00
R9772:Olfr916 UTSW 9 38657668 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTGGACCTGCCTTCAG -3'
(R):5'- ACCTAGTCACTGCATTGGGG -3'

Sequencing Primer
(F):5'- CTTTGGACCTGCCTTCAGAAGAATG -3'
(R):5'- CTAGTCACTGCATTGGGGAATTTATC -3'
Posted On 2015-02-05