Incidental Mutation 'R0324:Zbtb16'
ID26363
Institutional Source Beutler Lab
Gene Symbol Zbtb16
Ensembl Gene ENSMUSG00000066687
Gene Namezinc finger and BTB domain containing 16
SynonymsGreen's luxoid, Zfp145, PLZF
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.870) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location48654297-48836222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 48665275 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 502 (Q502K)
Ref Sequence ENSEMBL: ENSMUSP00000150887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093852] [ENSMUST00000216150]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093852
AA Change: Q502K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091374
Gene: ENSMUSG00000066687
AA Change: Q502K

DomainStartEndE-ValueType
BTB 34 126 1.41e-24 SMART
ZnF_C2H2 404 426 3.72e0 SMART
ZnF_C2H2 432 454 8.22e-2 SMART
ZnF_C2H2 461 483 2.24e-3 SMART
ZnF_C2H2 490 512 1.56e-2 SMART
ZnF_C2H2 518 540 1.63e-5 SMART
ZnF_C2H2 546 568 1.95e-3 SMART
ZnF_C2H2 574 596 5.9e-3 SMART
ZnF_C2H2 602 624 2.36e-2 SMART
ZnF_C2H2 630 652 2.24e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000216150
AA Change: Q502K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Krueppel C2H2-type zinc-finger protein family and encodes a zinc finger transcription factor that contains nine Kruppel-type zinc finger domains at the carboxyl terminus. This protein is located in the nucleus, is involved in cell cycle progression, and interacts with a histone deacetylase. Specific instances of aberrant gene rearrangement at this locus have been associated with acute promyelocytic leukemia (APL). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal anterior-posterior patterning, with skeletal abnormalities of the limb, especially the hindlimb, and homeotic transformations of anterior skeletal elements into posterior structures. Males develop infertility due to loss of germline cells with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pdss2 T C 10: 43,393,928 S256P probably damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Zbtb16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Zbtb16 APN 9 48657183 missense probably damaging 1.00
R0364:Zbtb16 UTSW 9 48743576 splice site probably benign
R1538:Zbtb16 UTSW 9 48832283 missense probably benign
R1575:Zbtb16 UTSW 9 48832272 missense probably damaging 0.96
R1937:Zbtb16 UTSW 9 48659778 missense probably benign
R2656:Zbtb16 UTSW 9 48832688 missense probably damaging 1.00
R4176:Zbtb16 UTSW 9 48659801 missense probably damaging 1.00
R4582:Zbtb16 UTSW 9 48832082 missense probably benign
R4595:Zbtb16 UTSW 9 48832080 missense possibly damaging 0.79
R6466:Zbtb16 UTSW 9 48665319 missense possibly damaging 0.95
R6966:Zbtb16 UTSW 9 48657354 missense probably damaging 1.00
R7596:Zbtb16 UTSW 9 48832404 missense possibly damaging 0.93
R7751:Zbtb16 UTSW 9 48743469 missense probably damaging 1.00
R7904:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
R7987:Zbtb16 UTSW 9 48832972 missense probably damaging 1.00
Z1176:Zbtb16 UTSW 9 48657288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGGTCCAGAGATGCTCCCCAC -3'
(R):5'- GTCACCTGCATTGCGTTCAAACC -3'

Sequencing Primer
(F):5'- GATGCTCCCCACCCATCC -3'
(R):5'- CGTTCAAACCTCTTGCAGAGATG -3'
Posted On2013-04-16