Incidental Mutation 'R3107:Sorcs1'
ID263648
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R3107 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50210650 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 825 (E825G)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072685
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: E825G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111756
AA Change: E825G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: E825G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164039
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: E825G

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209413
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209783
AA Change: E825G

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211008
AA Change: E825G

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211687
AA Change: E825G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Gprasp1 A T X: 135,799,759 M234L probably benign Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGAACTTGTCAGGGAAAG -3'
(R):5'- GGGAATATCCATTGCATCAGC -3'

Sequencing Primer
(F):5'- CTTGTCAGGGAAAGGGAGAGGATAC -3'
(R):5'- GGGAATATCCATTGCATCAGCTGATG -3'
Posted On2015-02-05