Incidental Mutation 'R3107:Gprasp1'
ID263649
Institutional Source Beutler Lab
Gene Symbol Gprasp1
Ensembl Gene ENSMUSG00000043384
Gene NameG protein-coupled receptor associated sorting protein 1
Synonyms2210415K24Rik, 3110031O14Rik, GASP1
MMRRC Submission 040581-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R3107 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location135742733-135803474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135799759 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 234 (M234L)
Ref Sequence ENSEMBL: ENSMUSP00000132225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113144] [ENSMUST00000113145] [ENSMUST00000113147] [ENSMUST00000166554]
Predicted Effect probably benign
Transcript: ENSMUST00000113144
AA Change: M234L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108769
Gene: ENSMUSG00000043384
AA Change: M234L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
internal_repeat_1 149 555 1.92e-17 PROSPERO
internal_repeat_2 259 559 1.83e-16 PROSPERO
internal_repeat_2 578 912 1.83e-16 PROSPERO
internal_repeat_1 584 970 1.92e-17 PROSPERO
low complexity region 1053 1064 N/A INTRINSIC
Pfam:Arm_2 1092 1339 1.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113145
AA Change: M234L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108770
Gene: ENSMUSG00000043384
AA Change: M234L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
internal_repeat_1 149 555 1.92e-17 PROSPERO
internal_repeat_2 259 559 1.83e-16 PROSPERO
internal_repeat_2 578 912 1.83e-16 PROSPERO
internal_repeat_1 584 970 1.92e-17 PROSPERO
low complexity region 1053 1064 N/A INTRINSIC
Pfam:Arm_2 1092 1339 2.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113147
AA Change: M234L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108772
Gene: ENSMUSG00000043384
AA Change: M234L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
internal_repeat_1 149 555 1.92e-17 PROSPERO
internal_repeat_2 259 559 1.83e-16 PROSPERO
internal_repeat_2 578 912 1.83e-16 PROSPERO
internal_repeat_1 584 970 1.92e-17 PROSPERO
low complexity region 1053 1064 N/A INTRINSIC
Pfam:Arm_2 1092 1339 2.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166554
AA Change: M234L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000132225
Gene: ENSMUSG00000043384
AA Change: M234L

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
internal_repeat_1 149 555 1.92e-17 PROSPERO
internal_repeat_2 259 559 1.83e-16 PROSPERO
internal_repeat_2 578 912 1.83e-16 PROSPERO
internal_repeat_1 584 970 1.92e-17 PROSPERO
low complexity region 1053 1064 N/A INTRINSIC
Pfam:Arm_2 1092 1339 1.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207433
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GPRASP (G protein-coupled receptor associated sorting protein) family. The protein may modulate lysosomal sorting and functional down-regulation of a variety of G-protein coupled receptors. It targets receptors for degradation in lysosomes. The receptors interacting with this sorting protein include D2 dopamine receptor (DRD2), delta opioid receptor (OPRD1), beta-2 adrenergic receptor (ADRB2), D4 dopamine receptor (DRD4) and cannabinoid 1 receptor (CB1R). Multiple alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired behavioral response to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,723,447 L814H probably damaging Het
Adgrf4 A T 17: 42,666,867 Y528* probably null Het
Ankrd26 A T 6: 118,556,243 F198L probably benign Het
Arnt2 A G 7: 84,262,444 S607P possibly damaging Het
Ccdc17 T C 4: 116,598,267 V269A probably benign Het
Cers1 T A 8: 70,322,636 H233Q probably benign Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cfb A G 17: 34,861,824 Y66H possibly damaging Het
Clspn A G 4: 126,591,659 D1247G probably benign Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Col19a1 T C 1: 24,337,936 T443A possibly damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Ddt C T 10: 75,772,763 E42K probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Dnah7b G A 1: 46,352,873 G3798E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fam114a2 C A 11: 57,499,735 K317N probably benign Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Ibtk T C 9: 85,710,414 Y997C probably damaging Het
Il12rb2 A G 6: 67,360,798 V33A probably damaging Het
Ints6 T C 14: 62,760,592 T23A possibly damaging Het
Itk C A 11: 46,327,464 G624V probably benign Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Mab21l3 T A 3: 101,826,796 I109F probably damaging Het
Mov10 T C 3: 104,799,724 E653G probably damaging Het
Olfr916 C T 9: 38,658,011 C127Y possibly damaging Het
Plg T C 17: 12,384,429 V74A probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbmxl2 G A 7: 107,210,417 G303E probably damaging Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc6a2 C A 8: 92,961,278 Q11K probably benign Het
Slc6a20a A C 9: 123,641,708 probably null Het
Sorcs1 T C 19: 50,210,650 E825G possibly damaging Het
Sval1 C G 6: 41,955,942 P145A probably damaging Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Vmn2r61 A T 7: 42,267,067 D368V possibly damaging Het
Other mutations in Gprasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Gprasp1 APN X 135799163 missense probably damaging 1.00
IGL02251:Gprasp1 APN X 135800539 missense probably benign
IGL02375:Gprasp1 APN X 135800803 missense probably damaging 0.99
IGL02503:Gprasp1 APN X 135802530 nonsense probably null
R2049:Gprasp1 UTSW X 135802042 missense possibly damaging 0.57
R2141:Gprasp1 UTSW X 135802042 missense possibly damaging 0.57
R2142:Gprasp1 UTSW X 135802042 missense possibly damaging 0.57
R4569:Gprasp1 UTSW X 135802843 missense probably damaging 0.97
R4570:Gprasp1 UTSW X 135802843 missense probably damaging 0.97
Z1088:Gprasp1 UTSW X 135799441 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAATATGGGGTCCTGGTACC -3'
(R):5'- TTCACATTCAGACCCAGAAGTGG -3'

Sequencing Primer
(F):5'- TACCGTGCCAGGCCTGTC -3'
(R):5'- AGTGGATTCAACACGGACTTC -3'
Posted On2015-02-05