Incidental Mutation 'R3108:Slc34a3'
ID263652
Institutional Source Beutler Lab
Gene Symbol Slc34a3
Ensembl Gene ENSMUSG00000006469
Gene Namesolute carrier family 34 (sodium phosphate), member 3
SynonymsNPTIIc, Npt2c
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25228898-25234364 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 25229245 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 538 (Q538K)
Ref Sequence ENSEMBL: ENSMUSP00000006638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006638] [ENSMUST00000043584]
Predicted Effect probably benign
Transcript: ENSMUST00000006638
AA Change: Q538K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006638
Gene: ENSMUSG00000006469
AA Change: Q538K

DomainStartEndE-ValueType
Pfam:Na_Pi_cotrans 84 231 1.8e-25 PFAM
low complexity region 254 269 N/A INTRINSIC
Pfam:Na_Pi_cotrans 337 538 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043584
SMART Domains Protein: ENSMUSP00000042342
Gene: ENSMUSG00000036752

DomainStartEndE-ValueType
Tubulin 47 244 1.04e-67 SMART
Tubulin_C 246 383 3.89e-49 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155420
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of SLC34A transporter family of proteins, and is expressed primarily in the kidney. It is involved in transporting phosphate into cells via sodium cotransport in the renal brush border membrane, and contributes to the maintenance of inorganic phosphate concentration in the kidney. Mutations in this gene are associated with hereditary hypophosphatemic rickets with hypercalciuria. Alternatively spliced transcript variants varying in the 5' UTR have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypercalciuria, hypercalcemia and increased plasma 1,25(OH)2D3 levels but do not develop hypophosphatemia, renal calcification, rickets, or osteomalacia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Slc34a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02422:Slc34a3 APN 2 25232263 missense probably benign 0.01
IGL02885:Slc34a3 APN 2 25231057 missense probably damaging 1.00
IGL03131:Slc34a3 APN 2 25231234 missense probably benign
IGL03166:Slc34a3 APN 2 25232174 missense probably damaging 0.99
IGL03278:Slc34a3 APN 2 25232047 missense probably benign 0.01
PIT4544001:Slc34a3 UTSW 2 25230595 missense probably benign 0.27
R0415:Slc34a3 UTSW 2 25229110 missense probably benign
R0558:Slc34a3 UTSW 2 25233065 unclassified probably benign
R0883:Slc34a3 UTSW 2 25231233 missense probably benign
R2107:Slc34a3 UTSW 2 25230987 missense probably damaging 0.99
R2329:Slc34a3 UTSW 2 25229410 missense possibly damaging 0.95
R4637:Slc34a3 UTSW 2 25229461 missense possibly damaging 0.92
R5008:Slc34a3 UTSW 2 25230842 missense possibly damaging 0.62
R5341:Slc34a3 UTSW 2 25230659 missense probably benign 0.00
R5623:Slc34a3 UTSW 2 25233300 splice site probably null
R6602:Slc34a3 UTSW 2 25229209 missense probably damaging 0.99
R7512:Slc34a3 UTSW 2 25232241 splice site probably null
R7784:Slc34a3 UTSW 2 25232225 missense probably damaging 1.00
R8072:Slc34a3 UTSW 2 25229277 missense probably benign 0.01
R8730:Slc34a3 UTSW 2 25232045 missense possibly damaging 0.80
R8762:Slc34a3 UTSW 2 25230991 missense probably benign 0.03
Z1176:Slc34a3 UTSW 2 25229398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTCTCATAGCAGTGAGC -3'
(R):5'- CATACTGCTGTGGTACCTGG -3'

Sequencing Primer
(F):5'- ATAGCAGTGAGCCACTTTGC -3'
(R):5'- CAAGCGCTTTGGAAACCTGACTG -3'
Posted On2015-02-05