Incidental Mutation 'R3108:Dclk2'
ID 263654
Institutional Source Beutler Lab
Gene Symbol Dclk2
Ensembl Gene ENSMUSG00000028078
Gene Name doublecortin-like kinase 2
Synonyms Dcamkl2, Click-II, 6330415M09Rik
MMRRC Submission 040582-MU
Accession Numbers

Genbank: NM_027539; MGI: 1918012

Essential gene? Non essential (E-score: 0.000) question?
Stock # R3108 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 86786151-86920852 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 86920035 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000142267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029719] [ENSMUST00000191752] [ENSMUST00000192773] [ENSMUST00000193632] [ENSMUST00000194452] [ENSMUST00000195561]
AlphaFold Q6PGN3
Predicted Effect probably damaging
Transcript: ENSMUST00000029719
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029719
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 650 4.96e-101 SMART
low complexity region 718 740 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191752
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141707
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 393 646 2.4e-76 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192773
AA Change: P46S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141567
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 641 8.6e-81 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193632
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141866
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 1.1e-44 SMART
DCX 191 279 9.9e-37 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 339 362 N/A INTRINSIC
S_TKc 409 666 2.4e-103 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194452
AA Change: P46S

PolyPhen 2 Score 0.576 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141816
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
Pfam:Pkinase_Tyr 392 590 2.2e-31 PFAM
Pfam:Pkinase 392 591 4.7e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000195561
AA Change: P46S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142267
Gene: ENSMUSG00000028078
AA Change: P46S

DomainStartEndE-ValueType
low complexity region 18 43 N/A INTRINSIC
DCX 67 158 2.29e-42 SMART
DCX 191 279 2.17e-34 SMART
low complexity region 291 317 N/A INTRINSIC
low complexity region 323 346 N/A INTRINSIC
S_TKc 392 649 4.96e-101 SMART
low complexity region 717 739 N/A INTRINSIC
Meta Mutation Damage Score 0.1082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: This gene encodes a member of the protein kinase superfamily and the doublecortin family. The protein encoded by this gene contains two N-terminal doublecortin domains, which bind microtubules and regulate microtubule polymerization, a C-terminal serine/threonine protein kinase domain, which shows substantial homology to Ca2+/calmoduline-dependent protein kinase, and a serine/proline-rich domain in between the doublecortin and the protein kinase domains, which mediates multiple protein-protein interactions. The microtubule-polymerizing activity of the encoded protein is independent of its protein kinase activity. This gene and the DCX gene, another family member, share function in the establishment of hippocampal organization and their absence results in a severe epileptic phenotype and lethality, as described in human patients with lissencephaly. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI

All alleles(59) : Targeted, knock-out(1) Gene trapped(58)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Dclk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dclk2 APN 3 86799090 critical splice acceptor site probably null
IGL01769:Dclk2 APN 3 86816360 missense possibly damaging 0.50
IGL01802:Dclk2 APN 3 86799027 missense probably damaging 1.00
IGL02296:Dclk2 APN 3 86793293 missense probably damaging 1.00
IGL02390:Dclk2 APN 3 86824683 missense probably damaging 0.99
IGL02522:Dclk2 APN 3 86920116 missense probably benign 0.01
IGL03104:Dclk2 APN 3 86836359 missense probably damaging 1.00
IGL03337:Dclk2 APN 3 86906059 missense probably damaging 1.00
R0219:Dclk2 UTSW 3 86813669 splice site probably benign
R0400:Dclk2 UTSW 3 86813747 splice site probably null
R0606:Dclk2 UTSW 3 86906004 missense probably damaging 1.00
R1537:Dclk2 UTSW 3 86806184 missense probably damaging 0.97
R1569:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1571:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1612:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1680:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1689:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1714:Dclk2 UTSW 3 86906093 missense probably benign 0.00
R1745:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1746:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R1752:Dclk2 UTSW 3 86806127 missense possibly damaging 0.61
R1829:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2008:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2125:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2126:Dclk2 UTSW 3 86805639 missense possibly damaging 0.50
R2132:Dclk2 UTSW 3 86920046 missense probably benign 0.44
R2314:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R2338:Dclk2 UTSW 3 86799017 missense probably damaging 1.00
R2849:Dclk2 UTSW 3 86793223 missense probably damaging 1.00
R3109:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3615:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R3616:Dclk2 UTSW 3 86920035 missense probably damaging 1.00
R4051:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4052:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4208:Dclk2 UTSW 3 86830822 critical splice donor site probably null
R4643:Dclk2 UTSW 3 86806180 missense possibly damaging 0.93
R4654:Dclk2 UTSW 3 86836376 missense probably damaging 1.00
R4693:Dclk2 UTSW 3 86815093 missense possibly damaging 0.67
R4716:Dclk2 UTSW 3 86919881 missense probably damaging 1.00
R4914:Dclk2 UTSW 3 86824742 splice site probably null
R4915:Dclk2 UTSW 3 86824742 splice site probably null
R4917:Dclk2 UTSW 3 86824742 splice site probably null
R5218:Dclk2 UTSW 3 86805678 missense probably damaging 1.00
R5510:Dclk2 UTSW 3 86906037 missense possibly damaging 0.93
R5520:Dclk2 UTSW 3 86919840 missense probably damaging 1.00
R5867:Dclk2 UTSW 3 86791859 makesense probably null
R5976:Dclk2 UTSW 3 86787225 missense possibly damaging 0.53
R6048:Dclk2 UTSW 3 86905965 missense probably damaging 1.00
R6111:Dclk2 UTSW 3 86805661 missense probably benign 0.28
R6192:Dclk2 UTSW 3 86815150 missense probably damaging 1.00
R6289:Dclk2 UTSW 3 86831817 missense probably benign 0.18
R6595:Dclk2 UTSW 3 86792067 critical splice donor site probably benign
R6897:Dclk2 UTSW 3 86831763 missense probably benign 0.00
R7061:Dclk2 UTSW 3 86831731 critical splice donor site probably null
R7095:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7096:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7208:Dclk2 UTSW 3 86799602 splice site probably null
R7253:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R7256:Dclk2 UTSW 3 86793259 missense probably damaging 1.00
R8003:Dclk2 UTSW 3 86793301 critical splice acceptor site probably null
R8061:Dclk2 UTSW 3 86813674 splice site probably benign
R8927:Dclk2 UTSW 3 86831741 missense probably damaging 1.00
R8928:Dclk2 UTSW 3 86831741 missense probably damaging 1.00
R8964:Dclk2 UTSW 3 86836391 missense probably damaging 1.00
R9704:Dclk2 UTSW 3 86920080 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TCTATGAGGAGCGCATCGAAGG -3'
(R):5'- AGGTGTCCCGCTGCTTTAAG -3'

Sequencing Primer
(F):5'- CGCATCGAAGGAACGGAAAC -3'
(R):5'- CGCTGCTTTAAGACGGGAC -3'
Posted On 2015-02-05