Incidental Mutation 'R3108:Nkpd1'
ID263658
Institutional Source Beutler Lab
Gene Symbol Nkpd1
Ensembl Gene ENSMUSG00000060621
Gene NameNTPase, KAP family P-loop domain containing 1
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R3108 (G1)
Quality Score110
Status Validated
Chromosome7
Chromosomal Location19517838-19525056 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19522978 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 227 (M227I)
Ref Sequence ENSEMBL: ENSMUSP00000147092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078908] [ENSMUST00000207576] [ENSMUST00000214205]
Predicted Effect probably damaging
Transcript: ENSMUST00000078908
AA Change: M227I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077943
Gene: ENSMUSG00000060621
AA Change: M227I

DomainStartEndE-ValueType
low complexity region 71 103 N/A INTRINSIC
low complexity region 129 158 N/A INTRINSIC
Pfam:KAP_NTPase 186 642 5.7e-29 PFAM
low complexity region 771 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207576
AA Change: M227I

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214205
AA Change: M77I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.6712 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Nkpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Nkpd1 APN 7 19518749 missense possibly damaging 0.71
IGL01140:Nkpd1 APN 7 19523462 missense possibly damaging 0.72
IGL01450:Nkpd1 APN 7 19523625 missense probably damaging 1.00
R0003:Nkpd1 UTSW 7 19519927 missense probably benign
R0626:Nkpd1 UTSW 7 19523174 missense probably benign 0.02
R1171:Nkpd1 UTSW 7 19524087 missense possibly damaging 0.94
R1637:Nkpd1 UTSW 7 19523979 missense probably benign 0.00
R1722:Nkpd1 UTSW 7 19523921 missense possibly damaging 0.84
R1823:Nkpd1 UTSW 7 19523252 missense probably damaging 1.00
R2141:Nkpd1 UTSW 7 19524237 missense probably damaging 0.99
R2224:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2225:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2226:Nkpd1 UTSW 7 19519820 missense probably benign 0.00
R2274:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2275:Nkpd1 UTSW 7 19523897 missense probably benign 0.01
R2374:Nkpd1 UTSW 7 19523975 missense possibly damaging 0.50
R4940:Nkpd1 UTSW 7 19523573 nonsense probably null
R5182:Nkpd1 UTSW 7 19523256 missense probably damaging 1.00
R5362:Nkpd1 UTSW 7 19523268 missense probably damaging 1.00
R5458:Nkpd1 UTSW 7 19524276 missense probably damaging 1.00
R5681:Nkpd1 UTSW 7 19523573 nonsense probably null
R5684:Nkpd1 UTSW 7 19523573 nonsense probably null
R5685:Nkpd1 UTSW 7 19523573 nonsense probably null
R6177:Nkpd1 UTSW 7 19523084 missense probably damaging 1.00
R6200:Nkpd1 UTSW 7 19524603 missense possibly damaging 0.55
R7348:Nkpd1 UTSW 7 19524416 missense probably damaging 0.99
R7356:Nkpd1 UTSW 7 19523774 missense probably damaging 1.00
R8239:Nkpd1 UTSW 7 19519828 missense probably benign
R8791:Nkpd1 UTSW 7 19524170 missense probably benign 0.08
Z1177:Nkpd1 UTSW 7 19523777 missense probably damaging 1.00
Z1177:Nkpd1 UTSW 7 19523952 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCATTCATTCCTGGAGTGGC -3'
(R):5'- GAACAGGAAGCGCACATTC -3'

Sequencing Primer
(F):5'- TTCCTGGAGTGGCCACAACTTAAG -3'
(R):5'- GCACATTCCTGCGCCGC -3'
Posted On2015-02-05