Incidental Mutation 'R3108:Pak4'
ID263659
Institutional Source Beutler Lab
Gene Symbol Pak4
Ensembl Gene ENSMUSG00000030602
Gene Namep21 (RAC1) activated kinase 4
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location28558819-28598185 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 28564344 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 322 (Y322*)
Ref Sequence ENSEMBL: ENSMUSP00000103918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032823] [ENSMUST00000040531] [ENSMUST00000108283]
Predicted Effect probably null
Transcript: ENSMUST00000032823
AA Change: Y322*
SMART Domains Protein: ENSMUSP00000032823
Gene: ENSMUSG00000030602
AA Change: Y322*

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108283
AA Change: Y322*
SMART Domains Protein: ENSMUSP00000103918
Gene: ENSMUSG00000030602
AA Change: Y322*

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183983
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die at midgestation exhibiting heart defects as well as impaired neuronal development and yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Pak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0025:Pak4 UTSW 7 28564283 missense probably damaging 1.00
R0531:Pak4 UTSW 7 28568054 missense possibly damaging 0.69
R0893:Pak4 UTSW 7 28559777 missense probably benign 0.21
R1108:Pak4 UTSW 7 28560242 missense probably damaging 1.00
R1801:Pak4 UTSW 7 28565190 missense probably damaging 1.00
R1844:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R4693:Pak4 UTSW 7 28564249 missense probably damaging 1.00
R5320:Pak4 UTSW 7 28568206 missense probably damaging 0.98
R5357:Pak4 UTSW 7 28564406 missense probably damaging 0.99
R5724:Pak4 UTSW 7 28564580 missense possibly damaging 0.94
R6047:Pak4 UTSW 7 28563036 missense probably benign 0.34
R6161:Pak4 UTSW 7 28565267 missense possibly damaging 0.95
R6241:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R6820:Pak4 UTSW 7 28563036 missense probably benign 0.34
R7262:Pak4 UTSW 7 28565200 missense possibly damaging 0.60
R7338:Pak4 UTSW 7 28564956 missense probably benign 0.37
R7681:Pak4 UTSW 7 28560230 missense probably damaging 1.00
R8709:Pak4 UTSW 7 28562544 missense probably benign 0.02
Z1088:Pak4 UTSW 7 28565228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATGGGCACTTGGGATGAC -3'
(R):5'- CATACCATGGCCCCTAATGG -3'

Sequencing Primer
(F):5'- ACAGGCAGGAGTCTTAGCC -3'
(R):5'- AGGAGTTCTGGGTCCCCATG -3'
Posted On2015-02-05