Incidental Mutation 'R0324:Pdss2'
ID26366
Institutional Source Beutler Lab
Gene Symbol Pdss2
Ensembl Gene ENSMUSG00000038240
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 2
Synonyms5430420P03Rik, kd, mDLP1, PLMP
MMRRC Submission 038534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0324 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43221486-43464882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43393928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 256 (S256P)
Ref Sequence ENSEMBL: ENSMUSP00000124046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095725] [ENSMUST00000159139] [ENSMUST00000160823]
Predicted Effect probably damaging
Transcript: ENSMUST00000095725
AA Change: S256P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093393
Gene: ENSMUSG00000038240
AA Change: S256P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 106 324 9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159139
AA Change: S256P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124864
Gene: ENSMUSG00000038240
AA Change: S256P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 323 7.9e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160823
AA Change: S256P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124046
Gene: ENSMUSG00000038240
AA Change: S256P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
Pfam:polyprenyl_synt 103 319 7.4e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162008
AA Change: S3P
SMART Domains Protein: ENSMUSP00000124440
Gene: ENSMUSG00000038240
AA Change: S3P

DomainStartEndE-ValueType
SCOP:d1uby__ 9 136 1e-16 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that synthesizes the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. Defects in this gene are a cause of coenzyme Q10 deficiency.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mutations in this gene result in renal abnormalities leading to early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik T C 17: 9,001,157 L357S probably benign Het
1700129C05Rik C T 14: 59,142,807 R14H probably damaging Het
4933417A18Rik A G 13: 34,924,613 N26S probably benign Het
Aatf A G 11: 84,512,139 probably null Het
Abca13 T A 11: 9,297,669 M2472K possibly damaging Het
Abcd3 C A 3: 121,769,167 Q540H probably null Het
Adam17 C T 12: 21,349,938 V156I probably benign Het
Adam26a A G 8: 43,568,453 S667P probably benign Het
Adcy10 A G 1: 165,564,249 K1333E probably benign Het
Apob G A 12: 8,010,521 R2968Q probably benign Het
Arap3 G A 18: 37,973,225 P1522S possibly damaging Het
Catsper1 A T 19: 5,336,545 S269C probably damaging Het
Cd209d A T 8: 3,878,258 S42R probably benign Het
Cntln T A 4: 85,092,695 V1049E probably damaging Het
Cracr2b T C 7: 141,463,746 F87L probably damaging Het
Crb3 T C 17: 57,065,133 L60P probably damaging Het
Crispld1 T C 1: 17,749,591 V271A probably benign Het
Cyp2c66 G T 19: 39,176,691 R372L probably benign Het
Ddx58 T C 4: 40,213,766 T586A probably benign Het
Deup1 G A 9: 15,582,533 R438W probably benign Het
Dnah6 C T 6: 73,173,558 E741K possibly damaging Het
Epha4 T C 1: 77,383,551 E703G probably damaging Het
Evc2 G A 5: 37,393,099 R819H probably damaging Het
Fam217a A C 13: 34,910,961 C272G possibly damaging Het
Fndc7 T C 3: 108,876,699 probably null Het
Foxs1 C T 2: 152,932,687 G149S probably benign Het
Galnt13 T C 2: 54,854,616 V109A probably benign Het
Hmgxb4 G A 8: 74,998,928 M7I probably benign Het
Klk1b1 T A 7: 43,970,741 C209* probably null Het
Klra10 A G 6: 130,272,650 probably null Het
Kntc1 A T 5: 123,778,112 K701N probably damaging Het
Lpgat1 T A 1: 191,749,642 L114Q probably damaging Het
Mecom T A 3: 29,963,112 Q468L probably damaging Het
Med15 T C 16: 17,697,612 T70A probably damaging Het
Msh6 T A 17: 87,986,620 Y934* probably null Het
Mtus1 T C 8: 41,084,395 T95A probably benign Het
Mylk3 C A 8: 85,352,906 R444S probably damaging Het
Nbea A G 3: 56,057,948 probably null Het
Nbeal1 T C 1: 60,292,873 V2242A probably damaging Het
Nhp2 A G 11: 51,622,507 T85A possibly damaging Het
Nlk A G 11: 78,572,431 S413P possibly damaging Het
Nmbr A G 10: 14,760,448 I54V possibly damaging Het
Nmur2 A T 11: 56,040,520 C122S probably damaging Het
Nudt13 G T 14: 20,311,515 V220L probably damaging Het
Olfr1025-ps1 G A 2: 85,917,951 V9M probably benign Het
Pclo G A 5: 14,669,433 G1195R unknown Het
Pcsk7 A G 9: 45,913,011 H276R possibly damaging Het
Pgf G T 12: 85,171,424 H116N probably benign Het
Pglyrp2 T C 17: 32,418,328 D242G probably benign Het
Plk2 G A 13: 110,397,708 R274K probably benign Het
Ppp6r3 G T 19: 3,464,693 P141T probably benign Het
Prss54 T C 8: 95,565,667 T95A probably benign Het
Rab3il1 A G 19: 10,028,289 D149G probably damaging Het
Rasgef1c T C 11: 49,961,230 probably null Het
Rhpn1 T C 15: 75,711,588 M334T probably damaging Het
Robo2 C T 16: 73,967,851 V630M probably damaging Het
Rptor C T 11: 119,892,641 R1154W probably damaging Het
Scnn1g A G 7: 121,740,555 I192M possibly damaging Het
Sit1 G A 4: 43,482,815 Q115* probably null Het
Slc13a2 T C 11: 78,404,524 N141S probably damaging Het
Slc19a2 C A 1: 164,256,775 T78K probably damaging Het
Snx14 A G 9: 88,405,238 probably null Het
Stil T A 4: 115,039,149 C944S probably benign Het
Tnfaip2 A G 12: 111,453,459 N675S probably damaging Het
Trim30c A G 7: 104,383,309 I270T possibly damaging Het
Ugt2a3 C T 5: 87,327,073 probably null Het
Vmn1r213 A T 13: 23,011,418 probably benign Het
Vmn2r8 A C 5: 108,797,941 probably null Het
Vps13c T C 9: 67,964,309 F3253L possibly damaging Het
Zbtb16 G T 9: 48,665,275 Q502K possibly damaging Het
Zfp143 A G 7: 110,077,147 K218E possibly damaging Het
Zfp946 A G 17: 22,454,436 N57S probably benign Het
Zfp985 T C 4: 147,582,857 Y61H probably benign Het
Zkscan1 G A 5: 138,097,523 R246Q probably damaging Het
Zpld1 A G 16: 55,251,615 F94L probably damaging Het
Zswim5 G T 4: 116,986,906 W1047L probably damaging Het
Other mutations in Pdss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02346:Pdss2 APN 10 43345643 missense possibly damaging 0.80
IGL03337:Pdss2 APN 10 43345593 missense probably damaging 1.00
IGL03340:Pdss2 APN 10 43394001 missense probably benign 0.00
R0277:Pdss2 UTSW 10 43372176 missense probably benign
R0323:Pdss2 UTSW 10 43372176 missense probably benign
R0508:Pdss2 UTSW 10 43221931 small deletion probably benign
R0654:Pdss2 UTSW 10 43221931 small deletion probably benign
R1472:Pdss2 UTSW 10 43413537 missense probably benign 0.00
R1801:Pdss2 UTSW 10 43345605 missense probably benign 0.29
R2024:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2025:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R2026:Pdss2 UTSW 10 43393875 missense possibly damaging 0.81
R4077:Pdss2 UTSW 10 43402522 missense probably benign
R4079:Pdss2 UTSW 10 43402522 missense probably benign
R4292:Pdss2 UTSW 10 43221838 missense probably benign
R4518:Pdss2 UTSW 10 43372150 missense probably damaging 0.99
R4603:Pdss2 UTSW 10 43372201 missense probably damaging 0.99
R4962:Pdss2 UTSW 10 43298912 missense possibly damaging 0.47
R5016:Pdss2 UTSW 10 43222005 missense probably damaging 1.00
R5610:Pdss2 UTSW 10 43439832 missense probably benign 0.00
R5888:Pdss2 UTSW 10 43221797 synonymous silent
R5972:Pdss2 UTSW 10 43298926 missense probably damaging 0.99
R7246:Pdss2 UTSW 10 43372176 missense probably benign
R7697:Pdss2 UTSW 10 43345548 missense probably damaging 1.00
R7765:Pdss2 UTSW 10 43464632 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGAAGCAGGAGTGTTGCTAGTCCG -3'
(R):5'- TGTATTTCAGGATGCAGAAGGCAGG -3'

Sequencing Primer
(F):5'- atcctcctgcctcagcc -3'
(R):5'- GGTGTGCAAATACCTTGTGACTC -3'
Posted On2013-04-16