Incidental Mutation 'R3108:Olfr591'
ID263665
Institutional Source Beutler Lab
Gene Symbol Olfr591
Ensembl Gene ENSMUSG00000057461
Gene Nameolfactory receptor 591
SynonymsMOR24-1P, GA_x6K02T2PBJ9-5889409-5888465
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103167074-103178340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103173086 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 184 (M184L)
Ref Sequence ENSEMBL: ENSMUSP00000150894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074272] [ENSMUST00000216581]
Predicted Effect probably damaging
Transcript: ENSMUST00000074272
AA Change: M184L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000073884
Gene: ENSMUSG00000057461
AA Change: M184L

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 9.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 255 7.1e-8 PFAM
Pfam:7tm_1 43 294 6.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216581
AA Change: M184L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218115
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Olfr591
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Olfr591 APN 7 103173451 missense probably damaging 1.00
IGL03307:Olfr591 APN 7 103173416 missense probably benign 0.00
R0082:Olfr591 UTSW 7 103173202 missense probably benign 0.05
R0389:Olfr591 UTSW 7 103173283 missense possibly damaging 0.48
R0843:Olfr591 UTSW 7 103173119 missense possibly damaging 0.74
R1378:Olfr591 UTSW 7 103173268 missense probably damaging 1.00
R1386:Olfr591 UTSW 7 103173367 missense probably benign 0.11
R1521:Olfr591 UTSW 7 103173451 missense probably benign 0.39
R1538:Olfr591 UTSW 7 103172986 missense probably damaging 0.97
R3109:Olfr591 UTSW 7 103173086 missense probably damaging 0.98
R5350:Olfr591 UTSW 7 103173559 missense probably damaging 0.99
R5488:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5489:Olfr591 UTSW 7 103173451 missense probably damaging 1.00
R5598:Olfr591 UTSW 7 103173634 start codon destroyed probably null 1.00
R5607:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R5608:Olfr591 UTSW 7 103172849 missense probably damaging 0.96
R6974:Olfr591 UTSW 7 103173235 missense probably damaging 0.99
R6994:Olfr591 UTSW 7 103172912 missense probably damaging 1.00
R7095:Olfr591 UTSW 7 103173046 missense probably benign 0.00
Z1088:Olfr591 UTSW 7 103172806 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGAGTCTTGAGTCTGGCATCC -3'
(R):5'- CTCTTGCTCAACCATGGAGTC -3'

Sequencing Primer
(F):5'- GAGTCTGGCATCCTTGGAAG -3'
(R):5'- AACCATGGAGTCTGGTTTCC -3'
Posted On2015-02-05