Incidental Mutation 'R3108:Cnot1'
ID263670
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene NameCCR4-NOT transcription complex, subunit 1
Synonyms6030411K04Rik
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95719451-95807464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95735749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1691 (V1691A)
Ref Sequence ENSEMBL: ENSMUSP00000096073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006]
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: V1686A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: V1686A

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: V1691A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: V1691A

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: V1684A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212340
Predicted Effect unknown
Transcript: ENSMUST00000212415
AA Change: V95A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212712
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Meta Mutation Damage Score 0.2288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
barge UTSW 8 95734129 missense probably benign 0.13
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7940:Cnot1 UTSW 8 95745647 frame shift probably null
R8004:Cnot1 UTSW 8 95752752 missense not run
R8061:Cnot1 UTSW 8 95765027 missense not run
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense not run
Predicted Primers PCR Primer
(F):5'- CAAAGCCCCATTTATCTTGTAGG -3'
(R):5'- GCTTCAGAAATTATGTAGTCCTTTGTG -3'

Sequencing Primer
(F):5'- TGGCTCAGTGGCTTAAAGTACAC -3'
(R):5'- GTGTTTGATTTCCAGCTCTAACAG -3'
Posted On2015-02-05