Incidental Mutation 'R3108:Dennd4a'
ID 263671
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene Name DENN domain containing 4A
Synonyms F730015K02Rik
MMRRC Submission 040582-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.465) question?
Stock # R3108 (G1)
Quality Score 217
Status Validated
Chromosome 9
Chromosomal Location 64718622-64826949 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 64819669 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1760 (K1760R)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
AlphaFold E9Q8V6
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: K1760R

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: K1760R

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213744
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217307
Meta Mutation Damage Score 0.0601 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 78,973,333 (GRCm39) S104L probably benign Het
Adcy1 A G 11: 7,119,453 (GRCm39) Y1032C probably damaging Het
Ap4e1 T C 2: 126,898,226 (GRCm39) probably null Het
Ccnb1 C T 13: 100,918,132 (GRCm39) probably null Het
Cfap54 T C 10: 92,830,545 (GRCm39) N1197S probably benign Het
Cnot1 A G 8: 96,462,377 (GRCm39) V1691A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Drd4 T A 7: 140,872,195 (GRCm39) V82E possibly damaging Het
Dtx2 G A 5: 136,050,670 (GRCm39) V323M probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fat1 G A 8: 45,498,210 (GRCm39) probably null Het
Igkv11-125 T C 6: 67,890,855 (GRCm39) F58L possibly damaging Het
Mrgprb1 A G 7: 48,097,076 (GRCm39) S279P possibly damaging Het
Muc5b C T 7: 141,412,496 (GRCm39) T1814M unknown Het
Nkpd1 G A 7: 19,256,903 (GRCm39) M227I probably damaging Het
Ntrk3 C T 7: 78,110,263 (GRCm39) V324M probably benign Het
Nup155 C A 15: 8,146,790 (GRCm39) T210K probably null Het
Or52s1b T A 7: 102,822,293 (GRCm39) M184L probably damaging Het
Or9s18 T C 13: 65,300,875 (GRCm39) V279A possibly damaging Het
Pak4 A T 7: 28,263,769 (GRCm39) Y322* probably null Het
Raph1 G A 1: 60,532,545 (GRCm39) A696V probably benign Het
Satb1 A T 17: 52,089,810 (GRCm39) Y346N possibly damaging Het
Serpina1a A T 12: 103,820,100 (GRCm39) I382N probably damaging Het
Slc34a3 G T 2: 25,119,257 (GRCm39) Q538K probably benign Het
Slf1 C T 13: 77,274,840 (GRCm39) probably benign Het
Ston1 G T 17: 88,943,583 (GRCm39) E330* probably null Het
Trhde C T 10: 114,427,971 (GRCm39) E442K probably damaging Het
Unc45a A G 7: 79,981,294 (GRCm39) probably benign Het
Zfp169 A G 13: 48,643,472 (GRCm39) S552P possibly damaging Het
Zfp229 T A 17: 21,965,797 (GRCm39) C676S probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64,819,044 (GRCm39) missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64,814,166 (GRCm39) missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64,749,903 (GRCm39) missense probably benign 0.00
IGL01827:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01828:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01829:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL01979:Dennd4a APN 9 64,801,691 (GRCm39) missense probably benign 0.00
IGL02100:Dennd4a APN 9 64,816,988 (GRCm39) splice site probably benign
IGL02339:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02341:Dennd4a APN 9 64,749,843 (GRCm39) nonsense probably null
IGL02584:Dennd4a APN 9 64,758,580 (GRCm39) missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64,769,609 (GRCm39) missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64,817,473 (GRCm39) splice site probably benign
IGL02701:Dennd4a APN 9 64,804,635 (GRCm39) missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64,769,696 (GRCm39) missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64,779,156 (GRCm39) missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64,795,808 (GRCm39) missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64,796,256 (GRCm39) missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64,779,164 (GRCm39) missense probably benign 0.32
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0010:Dennd4a UTSW 9 64,803,997 (GRCm39) missense probably benign 0.00
R0129:Dennd4a UTSW 9 64,800,576 (GRCm39) missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64,759,727 (GRCm39) missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64,769,673 (GRCm39) missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64,758,665 (GRCm39) critical splice donor site probably null
R1225:Dennd4a UTSW 9 64,818,957 (GRCm39) missense probably benign 0.03
R1311:Dennd4a UTSW 9 64,817,286 (GRCm39) missense probably benign 0.34
R1448:Dennd4a UTSW 9 64,813,327 (GRCm39) missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64,818,947 (GRCm39) missense probably benign 0.03
R1630:Dennd4a UTSW 9 64,779,164 (GRCm39) missense probably benign 0.32
R1709:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64,766,640 (GRCm39) critical splice donor site probably null
R1851:Dennd4a UTSW 9 64,769,312 (GRCm39) missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64,804,516 (GRCm39) missense probably benign 0.00
R1900:Dennd4a UTSW 9 64,804,618 (GRCm39) missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64,796,368 (GRCm39) missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64,749,772 (GRCm39) missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R1955:Dennd4a UTSW 9 64,759,749 (GRCm39) missense probably benign 0.02
R2049:Dennd4a UTSW 9 64,796,887 (GRCm39) missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64,813,256 (GRCm39) splice site probably null
R2138:Dennd4a UTSW 9 64,796,619 (GRCm39) missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64,759,699 (GRCm39) missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64,813,363 (GRCm39) missense probably benign 0.03
R3176:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64,796,275 (GRCm39) missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64,779,310 (GRCm39) missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64,759,857 (GRCm39) missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64,769,613 (GRCm39) missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64,819,174 (GRCm39) missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64,817,405 (GRCm39) missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64,801,689 (GRCm39) missense probably benign
R4701:Dennd4a UTSW 9 64,804,639 (GRCm39) missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64,804,531 (GRCm39) missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64,796,338 (GRCm39) missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64,803,872 (GRCm39) missense probably benign
R4881:Dennd4a UTSW 9 64,746,126 (GRCm39) missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64,813,285 (GRCm39) missense probably benign 0.00
R5225:Dennd4a UTSW 9 64,796,210 (GRCm39) missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64,811,509 (GRCm39) missense probably benign 0.07
R5649:Dennd4a UTSW 9 64,758,491 (GRCm39) splice site probably null
R5868:Dennd4a UTSW 9 64,804,011 (GRCm39) missense probably benign 0.02
R5876:Dennd4a UTSW 9 64,819,037 (GRCm39) missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64,794,227 (GRCm39) missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64,779,181 (GRCm39) missense probably benign 0.04
R6596:Dennd4a UTSW 9 64,759,702 (GRCm39) missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64,794,247 (GRCm39) missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64,759,771 (GRCm39) nonsense probably null
R7056:Dennd4a UTSW 9 64,814,205 (GRCm39) missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64,801,681 (GRCm39) missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64,803,756 (GRCm39) missense probably benign 0.05
R7238:Dennd4a UTSW 9 64,769,238 (GRCm39) missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64,804,551 (GRCm39) missense probably benign 0.01
R7454:Dennd4a UTSW 9 64,759,852 (GRCm39) missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64,780,326 (GRCm39) missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64,795,869 (GRCm39) missense probably benign 0.01
R7662:Dennd4a UTSW 9 64,759,713 (GRCm39) missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64,814,202 (GRCm39) missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64,780,275 (GRCm39) critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64,759,794 (GRCm39) missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64,780,312 (GRCm39) missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64,795,850 (GRCm39) missense probably benign 0.01
R8089:Dennd4a UTSW 9 64,756,457 (GRCm39) missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64,814,157 (GRCm39) missense probably benign 0.00
R8397:Dennd4a UTSW 9 64,796,391 (GRCm39) missense probably benign
R8425:Dennd4a UTSW 9 64,746,256 (GRCm39) missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64,794,161 (GRCm39) missense probably damaging 1.00
R8855:Dennd4a UTSW 9 64,819,672 (GRCm39) missense probably benign
R9219:Dennd4a UTSW 9 64,796,376 (GRCm39) missense probably damaging 0.96
R9275:Dennd4a UTSW 9 64,749,906 (GRCm39) missense probably damaging 1.00
R9376:Dennd4a UTSW 9 64,819,974 (GRCm39) missense probably benign 0.00
R9485:Dennd4a UTSW 9 64,814,388 (GRCm39) nonsense probably null
R9672:Dennd4a UTSW 9 64,800,640 (GRCm39) missense probably benign
R9746:Dennd4a UTSW 9 64,801,793 (GRCm39) missense probably benign
X0026:Dennd4a UTSW 9 64,804,602 (GRCm39) missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64,779,304 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAACTCTGCAGGCCTATTTC -3'
(R):5'- CACAGGATGCTTCTCATGGG -3'

Sequencing Primer
(F):5'- GCAGGCCTATTTCTATCATTAGTTG -3'
(R):5'- CAGGATGCTTCTCATGGGCTATAAC -3'
Posted On 2015-02-05