Incidental Mutation 'R3108:Zfp169'
ID263676
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Namezinc finger protein 169
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location48487647-48513451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48489996 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 552 (S552P)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110110
AA Change: S552P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: S552P

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177474
Predicted Effect possibly damaging
Transcript: ENSMUST00000177530
AA Change: S552P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: S552P

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Meta Mutation Damage Score 0.2625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48490763 unclassified probably benign
IGL03329:Zfp169 APN 13 48490794 unclassified probably benign
IGL03382:Zfp169 APN 13 48491163 unclassified probably benign
IGL03394:Zfp169 APN 13 48489924 missense possibly damaging 0.93
R0571:Zfp169 UTSW 13 48489690 missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48498854 missense probably benign 0.35
R1784:Zfp169 UTSW 13 48489819 missense possibly damaging 0.61
R3689:Zfp169 UTSW 13 48506901 splice site probably benign
R4444:Zfp169 UTSW 13 48490337 missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48490863 unclassified probably benign
R4719:Zfp169 UTSW 13 48490158 missense probably benign 0.06
R4745:Zfp169 UTSW 13 48490232 missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48490275 missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48491040 unclassified probably benign
R6053:Zfp169 UTSW 13 48498858 missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48490996 unclassified probably benign
R7084:Zfp169 UTSW 13 48498863 missense probably benign 0.10
R7679:Zfp169 UTSW 13 48498383 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGCACACAGGAATGGCTTC -3'
(R):5'- GAAGTTCAACCTCATCGGGCAC -3'

Sequencing Primer
(F):5'- CTAGCGAGGTTGAACTTCTGCC -3'
(R):5'- CCAGAGGATTCATACAGGGGAGTTAC -3'
Posted On2015-02-05