Incidental Mutation 'R3108:Zfp169'
ID 263676
Institutional Source Beutler Lab
Gene Symbol Zfp169
Ensembl Gene ENSMUSG00000050954
Gene Name zinc finger protein 169
Synonyms 4930429A13Rik, 1700025J14Rik
MMRRC Submission 040582-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.072) question?
Stock # R3108 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 48641123-48666927 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48643472 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 552 (S552P)
Ref Sequence ENSEMBL: ENSMUSP00000135414 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110110] [ENSMUST00000167682] [ENSMUST00000176176] [ENSMUST00000176949] [ENSMUST00000176996] [ENSMUST00000177530]
AlphaFold E9Q3R6
Predicted Effect possibly damaging
Transcript: ENSMUST00000110110
AA Change: S552P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105737
Gene: ENSMUSG00000050954
AA Change: S552P

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167682
SMART Domains Protein: ENSMUSP00000127591
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176176
SMART Domains Protein: ENSMUSP00000134793
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176949
SMART Domains Protein: ENSMUSP00000135695
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176996
SMART Domains Protein: ENSMUSP00000135520
Gene: ENSMUSG00000050954

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177474
Predicted Effect possibly damaging
Transcript: ENSMUST00000177530
AA Change: S552P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135414
Gene: ENSMUSG00000050954
AA Change: S552P

DomainStartEndE-ValueType
KRAB 14 74 9.74e-36 SMART
ZnF_C2H2 257 279 9.08e-4 SMART
ZnF_C2H2 285 308 2.2e-2 SMART
ZnF_C2H2 314 336 9.73e-4 SMART
ZnF_C2H2 342 364 2.86e-1 SMART
ZnF_C2H2 370 392 4.72e-2 SMART
ZnF_C2H2 398 420 4.24e-4 SMART
ZnF_C2H2 426 448 1.13e-4 SMART
ZnF_C2H2 454 476 2.2e-2 SMART
ZnF_C2H2 482 504 2.99e-4 SMART
ZnF_C2H2 510 532 2.57e-3 SMART
ZnF_C2H2 539 561 3.44e-4 SMART
ZnF_C2H2 567 589 3.69e-4 SMART
ZnF_C2H2 595 617 8.02e-5 SMART
ZnF_C2H2 623 645 1.26e-2 SMART
ZnF_C2H2 651 673 4.79e-3 SMART
ZnF_C2H2 679 701 1.3e-4 SMART
ZnF_C2H2 707 729 5.5e-3 SMART
Meta Mutation Damage Score 0.2625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous disruption of this locus does not result in an overt phenotype early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 78,973,333 (GRCm39) S104L probably benign Het
Adcy1 A G 11: 7,119,453 (GRCm39) Y1032C probably damaging Het
Ap4e1 T C 2: 126,898,226 (GRCm39) probably null Het
Ccnb1 C T 13: 100,918,132 (GRCm39) probably null Het
Cfap54 T C 10: 92,830,545 (GRCm39) N1197S probably benign Het
Cnot1 A G 8: 96,462,377 (GRCm39) V1691A probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dennd4a A G 9: 64,819,669 (GRCm39) K1760R probably benign Het
Drd4 T A 7: 140,872,195 (GRCm39) V82E possibly damaging Het
Dtx2 G A 5: 136,050,670 (GRCm39) V323M probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fat1 G A 8: 45,498,210 (GRCm39) probably null Het
Igkv11-125 T C 6: 67,890,855 (GRCm39) F58L possibly damaging Het
Mrgprb1 A G 7: 48,097,076 (GRCm39) S279P possibly damaging Het
Muc5b C T 7: 141,412,496 (GRCm39) T1814M unknown Het
Nkpd1 G A 7: 19,256,903 (GRCm39) M227I probably damaging Het
Ntrk3 C T 7: 78,110,263 (GRCm39) V324M probably benign Het
Nup155 C A 15: 8,146,790 (GRCm39) T210K probably null Het
Or52s1b T A 7: 102,822,293 (GRCm39) M184L probably damaging Het
Or9s18 T C 13: 65,300,875 (GRCm39) V279A possibly damaging Het
Pak4 A T 7: 28,263,769 (GRCm39) Y322* probably null Het
Raph1 G A 1: 60,532,545 (GRCm39) A696V probably benign Het
Satb1 A T 17: 52,089,810 (GRCm39) Y346N possibly damaging Het
Serpina1a A T 12: 103,820,100 (GRCm39) I382N probably damaging Het
Slc34a3 G T 2: 25,119,257 (GRCm39) Q538K probably benign Het
Slf1 C T 13: 77,274,840 (GRCm39) probably benign Het
Ston1 G T 17: 88,943,583 (GRCm39) E330* probably null Het
Trhde C T 10: 114,427,971 (GRCm39) E442K probably damaging Het
Unc45a A G 7: 79,981,294 (GRCm39) probably benign Het
Zfp229 T A 17: 21,965,797 (GRCm39) C676S probably damaging Het
Other mutations in Zfp169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Zfp169 APN 13 48,644,239 (GRCm39) unclassified probably benign
IGL03329:Zfp169 APN 13 48,644,270 (GRCm39) unclassified probably benign
IGL03382:Zfp169 APN 13 48,644,639 (GRCm39) unclassified probably benign
IGL03394:Zfp169 APN 13 48,643,400 (GRCm39) missense possibly damaging 0.93
BB010:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
BB020:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R0571:Zfp169 UTSW 13 48,643,166 (GRCm39) missense possibly damaging 0.71
R1714:Zfp169 UTSW 13 48,652,330 (GRCm39) missense probably benign 0.35
R1784:Zfp169 UTSW 13 48,643,295 (GRCm39) missense possibly damaging 0.61
R3689:Zfp169 UTSW 13 48,660,377 (GRCm39) splice site probably benign
R4444:Zfp169 UTSW 13 48,643,813 (GRCm39) missense possibly damaging 0.94
R4665:Zfp169 UTSW 13 48,644,339 (GRCm39) unclassified probably benign
R4719:Zfp169 UTSW 13 48,643,634 (GRCm39) missense probably benign 0.06
R4745:Zfp169 UTSW 13 48,643,708 (GRCm39) missense possibly damaging 0.71
R5288:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5384:Zfp169 UTSW 13 48,643,751 (GRCm39) missense possibly damaging 0.61
R5979:Zfp169 UTSW 13 48,644,516 (GRCm39) unclassified probably benign
R6053:Zfp169 UTSW 13 48,652,334 (GRCm39) missense probably damaging 1.00
R6823:Zfp169 UTSW 13 48,644,472 (GRCm39) unclassified probably benign
R7084:Zfp169 UTSW 13 48,652,339 (GRCm39) missense probably benign 0.10
R7679:Zfp169 UTSW 13 48,651,859 (GRCm39) missense probably damaging 0.99
R7933:Zfp169 UTSW 13 48,643,957 (GRCm39) missense unknown
R8298:Zfp169 UTSW 13 48,651,853 (GRCm39) nonsense probably null
R8322:Zfp169 UTSW 13 48,644,575 (GRCm39) missense unknown
R9047:Zfp169 UTSW 13 48,652,292 (GRCm39) missense probably damaging 1.00
R9124:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9126:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9131:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
R9132:Zfp169 UTSW 13 48,644,557 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCACACAGGAATGGCTTC -3'
(R):5'- GAAGTTCAACCTCATCGGGCAC -3'

Sequencing Primer
(F):5'- CTAGCGAGGTTGAACTTCTGCC -3'
(R):5'- CCAGAGGATTCATACAGGGGAGTTAC -3'
Posted On 2015-02-05