Incidental Mutation 'R3108:Ccnb1'
ID263679
Institutional Source Beutler Lab
Gene Symbol Ccnb1
Ensembl Gene ENSMUSG00000041431
Gene Namecyclin B1
SynonymsCcnb1-rs13, Cycb-4
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location100778650-100786570 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 100781624 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133962 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072119] [ENSMUST00000091295] [ENSMUST00000174038] [ENSMUST00000174038]
Predicted Effect probably null
Transcript: ENSMUST00000072119
SMART Domains Protein: ENSMUSP00000071989
Gene: ENSMUSG00000041431

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
CYCLIN 204 288 3.88e-26 SMART
Cyclin_C 297 415 4.18e-37 SMART
CYCLIN 301 382 3.65e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000091295
SMART Domains Protein: ENSMUSP00000088841
Gene: ENSMUSG00000041431

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
CYCLIN 143 227 3.88e-26 SMART
Cyclin_C 236 354 4.18e-37 SMART
CYCLIN 240 321 3.65e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134080
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147790
Predicted Effect probably null
Transcript: ENSMUST00000174038
SMART Domains Protein: ENSMUSP00000133962
Gene: ENSMUSG00000041431

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
CYCLIN 204 288 3.88e-26 SMART
Cyclin_C 297 378 3.18e-10 SMART
CYCLIN 301 384 8.4e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000174038
SMART Domains Protein: ENSMUSP00000133962
Gene: ENSMUSG00000041431

DomainStartEndE-ValueType
low complexity region 80 110 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
CYCLIN 204 288 3.88e-26 SMART
Cyclin_C 297 378 3.18e-10 SMART
CYCLIN 301 384 8.4e-13 SMART
Meta Mutation Damage Score 0.9600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Ston1 G T 17: 88,636,155 E330* probably null Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Ccnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Ccnb1 APN 13 100785911 splice site probably benign
IGL01775:Ccnb1 APN 13 100783509 missense probably benign 0.36
IGL01874:Ccnb1 APN 13 100783493 missense probably damaging 1.00
IGL02108:Ccnb1 APN 13 100781157 critical splice donor site probably null
IGL02170:Ccnb1 APN 13 100783486 nonsense probably null
IGL02372:Ccnb1 APN 13 100781316 missense probably damaging 1.00
IGL02755:Ccnb1 APN 13 100781660 missense possibly damaging 0.89
IGL03142:Ccnb1 APN 13 100783531 missense probably damaging 1.00
R0025:Ccnb1 UTSW 13 100779781 missense probably damaging 1.00
R0499:Ccnb1 UTSW 13 100780134 critical splice acceptor site probably null
R2249:Ccnb1 UTSW 13 100781319 missense possibly damaging 0.79
R4934:Ccnb1 UTSW 13 100781701 missense possibly damaging 0.49
R5126:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5127:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5180:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5181:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R5325:Ccnb1 UTSW 13 100781775 missense possibly damaging 0.88
R7024:Ccnb1 UTSW 13 100786380 critical splice donor site probably null
R7583:Ccnb1 UTSW 13 100779754 missense probably benign 0.06
R7632:Ccnb1 UTSW 13 100781701 missense probably benign 0.32
R7833:Ccnb1 UTSW 13 100781351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTACCTCCCAAGAAAGGATTCAG -3'
(R):5'- GGTCTTTATGGACACCGATGG -3'

Sequencing Primer
(F):5'- CTCCCAAGAAAGGATTCAGTTTCAGG -3'
(R):5'- CTTTATGGACACCGATGGTAGATG -3'
Posted On2015-02-05