Incidental Mutation 'R3108:Ston1'
ID263684
Institutional Source Beutler Lab
Gene Symbol Ston1
Ensembl Gene ENSMUSG00000033855
Gene Namestonin 1
Synonyms
MMRRC Submission 040582-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R3108 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88597684-88662586 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 88636155 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 330 (E330*)
Ref Sequence ENSEMBL: ENSMUSP00000131703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064035] [ENSMUST00000137138] [ENSMUST00000150023] [ENSMUST00000163588]
Predicted Effect probably null
Transcript: ENSMUST00000064035
AA Change: E330*
SMART Domains Protein: ENSMUSP00000067027
Gene: ENSMUSG00000033855
AA Change: E330*

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000112216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132384
Predicted Effect probably benign
Transcript: ENSMUST00000137138
SMART Domains Protein: ENSMUSP00000118522
Gene: ENSMUSG00000033855

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150023
AA Change: E330*
SMART Domains Protein: ENSMUSP00000122928
Gene: ENSMUSG00000033855
AA Change: E330*

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 707 5.5e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153613
Predicted Effect probably null
Transcript: ENSMUST00000163588
AA Change: E330*
SMART Domains Protein: ENSMUSP00000131703
Gene: ENSMUSG00000033855
AA Change: E330*

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
low complexity region 132 143 N/A INTRINSIC
low complexity region 380 391 N/A INTRINSIC
Pfam:Adap_comp_sub 396 711 2.1e-64 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal. Mouse embryonic fibroblasts derived from homozygous null mice display alterations in focal adhesion dynamics and an increase in cellular signaling and directional cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 C T 7: 79,323,585 S104L probably benign Het
Adcy1 A G 11: 7,169,453 Y1032C probably damaging Het
Ap4e1 T C 2: 127,056,306 probably null Het
Ccnb1 C T 13: 100,781,624 probably null Het
Cfap54 T C 10: 92,994,683 N1197S probably benign Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd4a A G 9: 64,912,387 K1760R probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Dtx2 G A 5: 136,021,816 V323M probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Mrgprb1 A G 7: 48,447,328 S279P possibly damaging Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Nkpd1 G A 7: 19,522,978 M227I probably damaging Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Nup155 C A 15: 8,117,306 T210K probably null Het
Olfr466 T C 13: 65,153,061 V279A possibly damaging Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Pak4 A T 7: 28,564,344 Y322* probably null Het
Raph1 G A 1: 60,493,386 A696V probably benign Het
Satb1 A T 17: 51,782,782 Y346N possibly damaging Het
Serpina1a A T 12: 103,853,841 I382N probably damaging Het
Slc34a3 G T 2: 25,229,245 Q538K probably benign Het
Slf1 C T 13: 77,126,721 probably benign Het
Trhde C T 10: 114,592,066 E442K probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Zfp169 A G 13: 48,489,996 S552P possibly damaging Het
Zfp229 T A 17: 21,746,816 C676S probably damaging Het
Other mutations in Ston1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Ston1 APN 17 88644443 missense probably benign 0.00
IGL01593:Ston1 APN 17 88637010 missense probably null 1.00
BB010:Ston1 UTSW 17 88636144 missense probably benign 0.10
BB020:Ston1 UTSW 17 88636144 missense probably benign 0.10
FR4449:Ston1 UTSW 17 88635525 missense probably benign 0.38
R0610:Ston1 UTSW 17 88635281 missense possibly damaging 0.49
R1421:Ston1 UTSW 17 88635793 missense probably benign 0.02
R1620:Ston1 UTSW 17 88635816 missense probably benign 0.01
R2002:Ston1 UTSW 17 88635529 missense probably benign 0.01
R3766:Ston1 UTSW 17 88635360 missense probably damaging 1.00
R4222:Ston1 UTSW 17 88636771 missense probably damaging 1.00
R4335:Ston1 UTSW 17 88635697 missense probably damaging 1.00
R4355:Ston1 UTSW 17 88637008 missense probably damaging 1.00
R4867:Ston1 UTSW 17 88635694 missense probably damaging 1.00
R4902:Ston1 UTSW 17 88645252 missense probably damaging 0.99
R5084:Ston1 UTSW 17 88636574 missense probably benign 0.00
R5434:Ston1 UTSW 17 88645311 utr 3 prime probably benign
R5700:Ston1 UTSW 17 88644339 missense probably damaging 1.00
R5858:Ston1 UTSW 17 88635631 missense possibly damaging 0.93
R5863:Ston1 UTSW 17 88635945 missense possibly damaging 0.64
R6458:Ston1 UTSW 17 88635303 missense probably benign 0.14
R6459:Ston1 UTSW 17 88636468 missense probably benign 0.16
R7012:Ston1 UTSW 17 88635985 missense probably damaging 1.00
R7466:Ston1 UTSW 17 88635901 missense probably benign 0.03
R7825:Ston1 UTSW 17 88636453 missense possibly damaging 0.78
R7933:Ston1 UTSW 17 88636144 missense probably benign 0.10
R8505:Ston1 UTSW 17 88635589 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGACACAGTCTCGTTTGTCCC -3'
(R):5'- TTAGCTCCTCTTCGACGGTAG -3'

Sequencing Primer
(F):5'- CAGAGCTGGATGGTCCTTC -3'
(R):5'- TAGTCAGAAACTCGAGGAAGTCAC -3'
Posted On2015-02-05