Incidental Mutation 'R3109:Per2'
List |< first << previous [record 24 of 30] next >> last >|
ID263685
Institutional Source Beutler Lab
Gene Symbol Per2
Ensembl Gene ENSMUSG00000055866
Gene Nameperiod circadian clock 2
SynonymsmPer2
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.226) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location91415982-91459324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91445575 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 164 (C164S)
Ref Sequence ENSEMBL: ENSMUSP00000066620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069620]
Predicted Effect probably benign
Transcript: ENSMUST00000069620
AA Change: C164S

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000066620
Gene: ENSMUSG00000055866
AA Change: C164S

DomainStartEndE-ValueType
PAS 179 246 3.23e1 SMART
PAS 319 385 5.75e-2 SMART
PAC 393 436 1.6e0 SMART
low complexity region 475 488 N/A INTRINSIC
low complexity region 821 834 N/A INTRINSIC
low complexity region 996 1014 N/A INTRINSIC
Pfam:Period_C 1040 1234 2.7e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185298
Meta Mutation Damage Score 0.1129 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene may increase the risk of getting certain cancers and have been linked to sleep disorders. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mutants have a partially functional circadian clock, exhibiting a short circadian period followed by loss of circadian rhythmicity in constant darkness. Mutants are also deficient in DNA damage responses and show increased sensitivity togamma radiation and tumor development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik A G 2: 152,442,456 E323G probably damaging Het
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in Per2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Per2 APN 1 91448833 missense probably damaging 0.98
IGL01350:Per2 APN 1 91430861 missense probably damaging 1.00
IGL01865:Per2 APN 1 91421517 missense probably benign 0.10
IGL01974:Per2 APN 1 91423718 missense probably benign 0.02
IGL02118:Per2 APN 1 91424309 missense probably damaging 0.99
IGL02271:Per2 APN 1 91445610 missense probably damaging 1.00
IGL02533:Per2 APN 1 91431002 missense possibly damaging 0.92
IGL02707:Per2 APN 1 91450728 missense possibly damaging 0.94
IGL02972:Per2 APN 1 91423981 missense possibly damaging 0.50
IGL03118:Per2 APN 1 91444619 nonsense probably null
IGL03125:Per2 APN 1 91450611 missense probably benign 0.00
IGL03375:Per2 APN 1 91424228 missense possibly damaging 0.76
IGL03388:Per2 APN 1 91444789 splice site probably benign
Kortiku UTSW 1 91423829 missense probably damaging 1.00
obst UTSW 1 91445539 missense probably benign 0.00
R7092_Per2_246 UTSW 1 91421431 missense probably damaging 1.00
rhythm UTSW 1 91429382 critical splice donor site probably null
ANU23:Per2 UTSW 1 91448833 missense probably damaging 0.98
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0029:Per2 UTSW 1 91423712 missense possibly damaging 0.58
R0542:Per2 UTSW 1 91438332 critical splice donor site probably null
R0764:Per2 UTSW 1 91429420 missense probably damaging 1.00
R1370:Per2 UTSW 1 91445557 missense possibly damaging 0.94
R1655:Per2 UTSW 1 91448768 missense probably damaging 1.00
R1688:Per2 UTSW 1 91423829 missense probably damaging 1.00
R1997:Per2 UTSW 1 91440859 missense probably damaging 1.00
R2891:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2893:Per2 UTSW 1 91445603 missense probably damaging 1.00
R2894:Per2 UTSW 1 91445603 missense probably damaging 1.00
R4125:Per2 UTSW 1 91429450 missense possibly damaging 0.71
R4997:Per2 UTSW 1 91450783 missense probably benign 0.02
R5110:Per2 UTSW 1 91429515 missense possibly damaging 0.57
R5478:Per2 UTSW 1 91432868 missense probably benign 0.09
R5590:Per2 UTSW 1 91427856 nonsense probably null
R5634:Per2 UTSW 1 91444707 missense probably benign 0.02
R5654:Per2 UTSW 1 91445501 splice site probably null
R5928:Per2 UTSW 1 91444651 missense probably damaging 1.00
R6241:Per2 UTSW 1 91421529 missense probably damaging 0.97
R6295:Per2 UTSW 1 91449872 missense unknown
R6345:Per2 UTSW 1 91448722 missense probably damaging 1.00
R6480:Per2 UTSW 1 91429382 critical splice donor site probably null
R6502:Per2 UTSW 1 91427763 missense probably benign 0.01
R6702:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6703:Per2 UTSW 1 91427949 missense probably damaging 1.00
R6790:Per2 UTSW 1 91445539 missense probably benign 0.00
R7043:Per2 UTSW 1 91419408 missense probably benign
R7092:Per2 UTSW 1 91421431 missense probably damaging 1.00
R7430:Per2 UTSW 1 91423983 nonsense probably null
R7555:Per2 UTSW 1 91435135 missense probably damaging 1.00
R7860:Per2 UTSW 1 91444759 missense probably damaging 0.99
R8046:Per2 UTSW 1 91435703 missense possibly damaging 0.56
R8142:Per2 UTSW 1 91421547 missense possibly damaging 0.90
R8261:Per2 UTSW 1 91433448 missense possibly damaging 0.87
R8277:Per2 UTSW 1 91420552 missense probably benign 0.15
R8534:Per2 UTSW 1 91423937 missense probably benign 0.09
R8685:Per2 UTSW 1 91450680 missense possibly damaging 0.88
R8703:Per2 UTSW 1 91424045 missense possibly damaging 0.92
X0011:Per2 UTSW 1 91420589 missense possibly damaging 0.85
Z1176:Per2 UTSW 1 91421493 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGAAGACTTCACTCGAGAATCACC -3'
(R):5'- TCCTAACAAAGGCCTGGTGTG -3'

Sequencing Primer
(F):5'- TCGAGAATCACCAACTTCGTG -3'
(R):5'- TGTGCCAGAGAAACTGTGCTC -3'
Posted On2015-02-05