Incidental Mutation 'R3109:6820408C15Rik'
ID263692
Institutional Source Beutler Lab
Gene Symbol 6820408C15Rik
Ensembl Gene ENSMUSG00000032680
Gene NameRIKEN cDNA 6820408C15 gene
Synonyms
MMRRC Submission 040583-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3109 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152415587-152444330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 152442456 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 323 (E323G)
Ref Sequence ENSEMBL: ENSMUSP00000037024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039961] [ENSMUST00000128737] [ENSMUST00000153713]
Predicted Effect probably damaging
Transcript: ENSMUST00000039961
AA Change: E323G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037024
Gene: ENSMUSG00000032680
AA Change: E323G

DomainStartEndE-ValueType
Pfam:DUF4618 96 353 4.1e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128737
SMART Domains Protein: ENSMUSP00000117627
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
Pfam:DUF4618 97 158 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153713
SMART Domains Protein: ENSMUSP00000120724
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.4086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 T C 15: 94,345,904 probably benign Het
Alkbh3 T C 2: 94,004,763 E80G probably damaging Het
Amfr T C 8: 94,000,306 Y93C probably damaging Het
Arid2 T C 15: 96,356,746 Y158H probably damaging Het
Camk1g T C 1: 193,354,993 Y133C probably damaging Het
Cnnm1 T C 19: 43,441,561 C373R probably damaging Het
Cnot1 A G 8: 95,735,749 V1691A probably damaging Het
Cubn T C 2: 13,362,347 S1571G possibly damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dennd1b G A 1: 139,041,916 probably benign Het
Dmrt2 C A 19: 25,677,691 T218N probably benign Het
Drd4 T A 7: 141,292,282 V82E possibly damaging Het
Fat1 G A 8: 45,045,173 probably null Het
Fyn G C 10: 39,551,455 D445H probably damaging Het
Igfn1 T C 1: 135,997,848 D56G probably benign Het
Igkv11-125 T C 6: 67,913,871 F58L possibly damaging Het
Klhdc4 A C 8: 121,821,334 H72Q probably damaging Het
Kmt2c A G 5: 25,275,735 Y1459H probably damaging Het
Lama2 C T 10: 27,001,235 E2652K probably benign Het
Muc5b C T 7: 141,858,759 T1814M unknown Het
Ntrk3 C T 7: 78,460,515 V324M probably benign Het
Olfr591 T A 7: 103,173,086 M184L probably damaging Het
Per2 A T 1: 91,445,575 C164S probably benign Het
Ptprn2 A G 12: 116,876,180 D441G probably benign Het
Rbl2 T A 8: 91,102,235 I588N probably benign Het
Rslcan18 C T 13: 67,098,607 E314K possibly damaging Het
Ubr3 A T 2: 69,988,840 T1325S probably damaging Het
Unc45a A G 7: 80,331,546 probably benign Het
Vmn1r175 A G 7: 23,808,968 V78A probably benign Het
Other mutations in 6820408C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:6820408C15Rik APN 2 152442387 missense possibly damaging 0.89
IGL01986:6820408C15Rik APN 2 152441036 missense possibly damaging 0.84
IGL02153:6820408C15Rik APN 2 152441241 missense probably benign 0.06
IGL02178:6820408C15Rik APN 2 152428001 splice site probably benign
IGL03339:6820408C15Rik APN 2 152442456 missense probably damaging 1.00
R0468:6820408C15Rik UTSW 2 152441266 missense probably benign 0.01
R1624:6820408C15Rik UTSW 2 152434111 missense probably damaging 0.98
R1642:6820408C15Rik UTSW 2 152440854 missense probably damaging 1.00
R2420:6820408C15Rik UTSW 2 152429001 missense probably damaging 1.00
R3153:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3154:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3875:6820408C15Rik UTSW 2 152434080 missense probably benign
R4237:6820408C15Rik UTSW 2 152428953 missense possibly damaging 0.46
R4746:6820408C15Rik UTSW 2 152440765 missense probably benign 0.13
R4957:6820408C15Rik UTSW 2 152444093 missense probably damaging 1.00
R4959:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R4973:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R5261:6820408C15Rik UTSW 2 152440857 missense probably damaging 1.00
R5399:6820408C15Rik UTSW 2 152440868 missense probably damaging 1.00
R5971:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6138:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6223:6820408C15Rik UTSW 2 152427953 missense probably benign 0.00
R6379:6820408C15Rik UTSW 2 152427992 missense probably benign 0.01
R6642:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6815:6820408C15Rik UTSW 2 152441055 missense probably benign 0.29
R8083:6820408C15Rik UTSW 2 152441067 missense possibly damaging 0.94
U15987:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATCTGAGAGGCACATTCC -3'
(R):5'- ACCTGGTTCAACTACACCAG -3'

Sequencing Primer
(F):5'- TGCATCTTAGTGACAGGGCACATC -3'
(R):5'- CAGAAGTGGAAGGAAAGCTACATC -3'
Posted On2015-02-05